• Journal of Photoscience
• /
• 제10권1호
• /
• pp.37-48
• /
• 2003

A review of the background and development of the p-hydroxyphenacyl group (pHP) as a photoprotecting group for biological substrates is chronicled. The pHP group has promise as an efficient, rapid phototrigger for the study of very fast biological processes. Applications include the release of neurotransmittors and second messengers, enzyme switches and nucleotides.

• Journal of Ginseng Research
• /
• 제10권1호
• /
• pp.55-65
• /
• 1986

GMP를 비롯한 여러가지 누클레오티드들, 긴세노시드 $Rb_2$ 및 산화 환원제들이 쥐의 뇌에서 얻은 입자상 및 가용성 guanylate cyclase의 활동성에 미치는 영향을 조사하였다. GMP, AMP, ADP 및 ATP 들은 낮은 농도에서는 입자상 guanylate cyclase의 활동성에 별로 영향을 미치지 않지만, 그들의 농도가 증가함에 따라서 이 효소들에 대한 억제효과가 증가하였다. 마찬가지로, 가용성 guanylate cyclase의 활동성도 누클레오티드들의 농도가 증가함에 따라서 억제되었다. GMP, AMP, ADP 및 ATP 들의 입자상 guanylate cyclase와 가용성 guanylate cyclase의 활동성에 대한 억제 효과는 긴세노시드 $Rb_2$에 의해서 감소되었다. 이것은 guanylate cyclase분자에 누클레오티드들과 긴세노시드 $Rb_2$에 대한 특이한 결합자리가 있다는 것을 암시하는 것으로 생각된다.$NAD^+$는 입자상 guanylate cyclase의 활동성에 거의 영향을 미치지 않지만, NADH는 이 효소계의 활동성을 억제한다. 입자상 guanylate cyclase는 많이 억제되었다.

• 한국응용과학기술학회지
• /
• 제33권2호
• /
• pp.304-310
• /
• 2016

식염 5%를 첨가한 저염 오징어 젓갈을 $10^{\circ}C$에서 8주간 숙성시키면서 핵산관련물질의 변화를 분석하였다. 숙성발효에 따른 정미성분의 변화를 보면, 핵산관련물질 중 ATP 및 ADP는 소실되어 검출되지 않았으며 초기에만 AMP가 존재하고 숙성중반까지 현저히 감소한 반면에 inosine 및 hypoxanthine은 숙성중반까지 증가하였다가 다시 감소하였으며 핵산관련물질의 대부분을 차지하였다. pH는 식염농도가 낮고 숙성온도가 높을수록 숙성후반까지 계속 유의성 높게 증가하여 숙성이 촉진되었으며 적정산도는 숙성후반까지 감소하였다. 이상의 결과처럼 저염 오징어 젓갈의 적정 발효조건을 추정해 보면 발효온도 $10^{\circ}C$, 식염 10%, 발효기간 5주로 추정되어 활용가치가 높다고 사료된다.

• The Korean Journal of Physiology and Pharmacology
• /
• 제15권1호
• /
• pp.31-36
• /
• 2011

To understand the roles of purinergic receptors and cellular molecules below the receptors in the vascular inflammatory response, we determined if extracellular nucleotides up-regulated chemokine expression in vascular smooth muscle cells (VSMCs). Human aortic smooth muscle cells (AoSMCs) abundantly express $PSY_1$, $PSY_6$, and $PSY_{11}$ receptors, which all respond to extracellular nucleotides. Exposure of human AoSMCs to $NAD^+$, an agonist of the human $PSY_{11}$ receptor, and $NADP^+$ as well as ATP, an agonist for $PSY_1$ and $PSY_{11}$ receptors, caused increase in chemokine (C-C motif) ligand 2 gene (CCL2) transcript and CCL2 release; however, UPT did not affect CCL2 expression. CCL2 release by $NAD^+$ and $NADP^+$ was inhibited by a concentration dependent manner by suramin, an antagonist of P2-purinergic receptors. $NAD^+$ and $NADP^+$ activated protein kinase C and enhanced phosphorylation of mitogen-activated protein kinases and Akt. $NAD^+$- and $NADP^+$-mediated CCL2 release was significantly attenuated by SP6001250, U0126, LY294002, Akt inhibitor IV, RO318220, GF109203X, and diphenyleneiodium chloride. These results indicate that extracellular nucleotides can promote the proinflammatory VSMC phenotype by up-regulating CCL2 expression, and that multiple cellular elements, including phosphatidylinositol 3-kinase, Akt, protein kinase C, and mitogen-activated protein kinases, are involved in that process.

• 대한약리학회지
• /
• 제13권2호
• /
• pp.41-48
• /
• 1977

In 1968, Case et al. first studied the importance of cyclic AMP as an intermediate in the action of secretin and cholecystokinin-pancreozymin and they suggested that the action of secretin, not that of cholecystokinin-pancreozymin, may be mediated through cyclic AMP. Recently Albano et al. reported that in the exocrine pancreas each of the two major physiological functions is modulated a specific cyclic nucleotide, enzyme secretion by cyclic GMP, and fluid and ionic secretion by cyclic AMP. But in pancreas still conflicting results have been reported on the role of cyclic nucleotides in enzyme and electrolyte secretion. In these study, the role of cyclic nucleotides in the exocrine pancreatic secretion was examined. The results are as follows. 1) Very strong stimulation on amylase release from guinea pig pancreatic slice was produced by 1 unit of cholecystokinin-pancreozymin but as compared to that of cholecystokinin-pancreozymin very weak response was observed by 1 unit of secretion or $1\;{\mu}g$ of VIP. 2) Both cholecystokinin-pancreozymin and acetylcholine produced a rapid and marked rise in cyclic GMP as well as cyclic AMP in isolated pancreatic tissue. However, both secretin and VIP failed to alter significantly the basal level of cyclic GMP in pancreatic fragments. 3) Atropine inhibited acetylcholine mediated amylase release, but did not affect the cholecystokinin-pancreozymin response. Furthermore, atropine pretreatment produced a marked inhibitory effect on the increase of tissue cyclic nucleotides induced by cholecystokinin-pancreozymin and acetylcholine. In summary, these results suggest that whereas the pancreatic secretion produced by secretin and VIP is modulated by the formation of cyclic AMP, the pancreatic enzyme secretion in response to cholecystokinin-pancreozymin and acetylcholine is triggered by both cyclic AMP and cyclic GMP.

• Fisheries and Aquatic Sciences
• /
• 제6권4호
• /
• pp.180-186
• /
• 2003

The full-length cDNA encoding the pre-protein growth hormone (sfGH) from spotted flounder (Verasper variegatus) was amplified by the rapid amplification of cDNA ends (RACE) using degenerated oligonucleotide primers derived from conserved growth hormone sequences. It consists of 901 nucleotides in length, including the coding region of 609 nucleotides, 111 nucleotides of a 5' untranslated region, and 181 nucleotides of a 3' untranslated region. The conserved polyadenylation signal (AATAAA) lies 12 bases upstream from the poly (A) tail. The deduced amino acid sequence shows an open reading frame encoding a pre-protein of 203 amino acids and a putative signal peptide of 17 amino acids, suggesting that the mature hormone consists of 186 amino acids. The analyses of sfGH reveal some unique structural features. The repetitive sequences are located in the 5' untranslated region of sfGH cDNA and consist of tandem arrays of imperfect direct repeat monomers. Moreover, sfGH contains six Cys residues, as opposed to four or five in other GHs, and it is clearly distinguishable from olive flounder (Paralichthys olivaceus) GH, which lacks a region corresponding to residues 175-188 in alignment positions. It has important implications from an evolutionary standpoint, suggesting possible divergence among flatfishes.

• Journal of Plant Biology
• /
• 제35권2호
• /
• pp.155-163
• /
• 1992

식물세포에 tumor를 유발하는 Agrobacterium tumefaciens pTiA6 plasmid에서 virE 유전자의 발현조절기작을 분자적수준에서 규명하기 위하여 virE promoter의 5＇-말단을 제거하여 얻은 truncated virE 재조합플라스미드를 이용하여 virE promoter의 조절부위에 대하여 연구하였다. virE promoter의 기능이 존재하는 truncated virE 재조합플라스미드인 pJS201은 전기영동에 의하여 virE promoter의 5＇-말단으로부터 약 130개의 염기가 제거된 것으로 측정되었다. 한편 virE promoter의 기능을 상실한 pJS301에서 dideoxy chain termination방법으로 truncated virE promoter 염기서열을 결정한 결과 263개의 염기가 제거된 것으로 확인되었다. 따라서 virE promoter의 조절부위는 virE promoter의 5＇-말단으로부터 약 130번째의 염기에서 263번째의 염기사이에 존재하는 것으로 사료되며, 이 사이에 23개의 염기로 이루어진 역반복서열(AACTTTGCGCTATAGGCAAAGTT)이 존재하고 있는데, 이 부위가 virE operon의 발현에 있어서 RNA polymerase의 최초 인식부위(recognition site)일 것으로 사료된다.

• 한국식품영양과학회지
• /
• 제24권2호
• /
• pp.274-279
• /
• 1995

미더덕의 계절에 따른 성분 조성을 분석하여 식품학적 기초자료를 얻고자 3~10월 사이의 정미성분과 그 계절적 변화를 실험한 결과를 요약하면 다음과 같다. 미더덕의 총엑스분질소량은 6월에 294mg/100g, 7월에 160mg/100g으로 감소하다가 그 이후 증가하는 경향을 보였으며, 유리아미노산 중 taurine(45~50%)과 proline(12~18%)이 가장 많았으며, 그밖에 glutamic acid, alanine, glycine의 함량이 많았다. 핵산관련물질 중에서는 AMP의 함량이 가장 풍부하였고, glycine betain은 6월에 256mg/100g으로 최고치를 보였다. 미더덕의 엑스 분질소 조성은 유리아미노산이 50~62%로 가장 높았으며, 다음으로 betaine(11~15%), 핵산관련 물질(5~8%), TMAO 및 총 ceratinine 순이었다. 미더덕의 유기산은 succine, malic, lactic 및 pyroglutamic acid가 전체 유기산의 80% 이상을 차지하였으며, 그 중 succinic acid의 함량이 가장 높았다. Omission test한 결과, 미더덕의 맛은 유리아미노산, betaine, 핵산관련 물질, 불휘발성 유기산 순으로 영향을 미치는 것으로 나타났다.

• Molecules and Cells
• /
• 제23권2호
• /
• pp.228-238
• /
• 2007

Since molecular structure of hnRNP is not available in foreseeable future, it is best to construct a working model for hnRNP structure. A geometric problem, assembly of $700{\pm}20$ nucleotides with 48 proteins, is visualized by a frame work in which all the proteins participate in primary binding, followed by secondary, tertiary and quaternary binding with neighboring proteins without additional import. Thus, 40S hnRNP contains crown-like secondary structure (48 stemloops) and appearance of 6 petal (octamers) rose-like architectures. The proteins are wrapped by RNA. Co-transcriptional folding for RNP fibril of FMR1 gene can produce 2,571 stem-loops with frequency of 1 stem-loop/15.3 nucleotides and 53 40S hnRNP beaded structure. By spliceosome driven reactions, there occurs removal of 16 separate lariated RNPs, joining 17 separate beaded exonic structures and anchoring EJC on each exon junction. Skipping exon 12 has 5'GU, 3'AG and very compact folding pattern with frequency of 1 stem-loop per 12 nucleotides in short exon length (63 nucleotides). 5' end of exon 12 contains SS (Splicing Silencer) element of UAGGU. In exons 10, 15 and 17 where both regular and alternative splice sites exist, SS (hnRNP A1 binding site) is observed at the regular splicing site. End products are mature FMR-1 mRNP, 4 species of Pri-microRNAs derived from introns 7,9,15 and 3'UTR of exon17, respectively. There may also be some other regulatory RNAs containing ALU/Line elements as well.

• 한국식품조리과학회지
• /
• 제17권5호
• /
• pp.517-522
• /
• 2001

Changes of nucleotides and their related compounds in raw, cooked and frozen fish muscle were studied with HPLC. Red sea bream(cultured and wild) and flounder(cultured, cultured with Obosan(equation omitted) and wild) were used for this study. In nucleotides, contents of ATP was similar to that of IMP and some of H$\times$R(inosine) and H$\times$(hypoxanthine) were existed in fresh muscle. ATP was decomposed rapidly and contents of IMP became different between cultured and wild fish after 6 hours. The content of IMP was lower in the cultured red sea bream(3.39$\mu$ mole/g) and flounder(3.17$\mu$ mole/g) than in the wi1d red sea bream(7.31$\mu$ mole/g) and flounder(5.03$\mu$ mole/g). But, the flounder cultured with Obosan contained the largest amounts of IMP After 24 hours, K values of cultured fish muscle(27.7%, 28.2%) were higher than that of wild ones(22.8%, 24.3%). The K value of cultured flounder fed with 0.3% Obosan(equation omitted)(25.7%) was between cultured and wild flounder. IMP was the one which existed the most in cooked and frozen muscle. Amounts of H$\times$R and H$\times$ were more in cooked and frozen muscle. than in raw muscle. From these results, we could suggest that the wild one was more palatable and fresher than the cultured one and the palatability of cultured one seemed to be improved depanding on the feed.