Kim, Jin-Man;Park, Hee-Kyung;Park, Young-Seo;Yum, Do-Young;Bai, Dong-Hoon
Journal of Microbiology and Biotechnology
/
제3권3호
/
pp.146-155
/
1993
A DNA fragment from an alkali-tolerent Bacillus sp., conferring strong promoter activity, was subcloned into the promoter probe plasmid pPL703 and the nucleotide sequence of this promoter region was determined. The sequence analysis suggested that this highly efficient promoter region containing the complex clustered promoters comprised three kinds of promoters (P1, P2 and P3), which are transcribed by $\sigma^B (formerly \sigma^{37}), \sigma^E(formerly \sigma^{29}) and \sigma^A (formerly \sigma^{43})$ RNA polymerase holoenzymes which play major rules at the onset of endospore formation, during sporulation and at the vegetative phase of growth, respectively. S1 nuclease mapping experiments showed that all three promoters had staggered transcription initiation points. The results of chloramphenicol acetyltransferase assay after the subcloning experiments also indicated that the expression of these clustered promoters was correlated with the programs of growth and endospore development. Promoter P1, P2 and P3 were preceded by 75% AT, 79% AT and 81% AT regions, respectively, and a partial deletion of AT-rich region prevented transcription from promoter P1 in vivo. Two sets of 5 -AGTGTT-3 sequences and inverted repeat sequences located around the promoter P1 were speculated as the possible cis acting sites for the catabolite repression in B. subtilis. In vivo transcripts from these sequence regions may be able to form a secondary structure, however, the possibility that a regulatory protein induced by the excess amount of glucose could be bound to such a domain for crucial action remains to be determined.
식물세포에 tumor를 유발하는 Agrobacterium tumefaciens pTiA6 plasmid에서 virE 유전자의 발현조절기작을 분자적수준에서 규명하기 위하여 virE promoter의 5'-말단을 제거하여 얻은 truncated virE 재조합플라스미드를 이용하여 virE promoter의 조절부위에 대하여 연구하였다. virE promoter의 기능이 존재하는 truncated virE 재조합플라스미드인 pJS201은 전기영동에 의하여 virE promoter의 5'-말단으로부터 약 130개의 염기가 제거된 것으로 측정되었다. 한편 virE promoter의 기능을 상실한 pJS301에서 dideoxy chain termination방법으로 truncated virE promoter 염기서열을 결정한 결과 263개의 염기가 제거된 것으로 확인되었다. 따라서 virE promoter의 조절부위는 virE promoter의 5'-말단으로부터 약 130번째의 염기에서 263번째의 염기사이에 존재하는 것으로 사료되며, 이 사이에 23개의 염기로 이루어진 역반복서열(AACTTTGCGCTATAGGCAAAGTT)이 존재하고 있는데, 이 부위가 virE operon의 발현에 있어서 RNA polymerase의 최초 인식부위(recognition site)일 것으로 사료된다.
KP elements derived from Korean populations (Seoul, Cheonan and Taegu) of Drosophila melunoguster were examined for their molecular structure. The entire 1.15 kb sequence of the three KP elements KC-137 (Cheonan), KS-95 (Seoul) and KT-99 (Taegu) have been obtained by PCR amplification using inverted repeat primers and DNA sequencing. The 1.15 kb fragments of KP elements were cloned into pCRmll vector plasmids, and subsequently sequenced. The sequence of the three KP elements in these populations suggested that there might have been derived from the complete P element by a 1753 bp internal deletion between positions 808 and 2560. Therefore these KP elements were confirmed to be identical to that isolated from M'10 strains widely distributed in most Eurasian populations of D. melanoguster. Sequence comparison with the 2.9 kb complete P element in pn25.1 revealed that KC-137 has only shown to be two base substitutions of A to G and G to A at positions 62 and 242, respectively. The retained sequence of the two KP elements KS-95 and KT-99 shows complete homology to the P factor in pn25.1. Based on this result, the two base substitutions in KC-137 might be due to Taq DNA pollunerase errors. Finally, it is suggested that the high copy numbers of KP elements provieds an explanation for the suppression of P-mediated hybrid dvssenesis in Korean population of D. melunogoster.
A gene coding for phosphoketolase, a key enzyme of carbohydrate catabolism in heterofermentative lactic acid bacteria(LAB), was cloned from a Lactobacillus paraplantarum C7 and expressed in Escherichia coli. The gene is 2,502 bp long and codes for a 788-amino-acids polypeptide with a molecular mass of 88.7 kDa. A Shine-Dalgarno sequence(aaggag) and an inverted-repeat terminator sequence are located upstream and downstream of the phosphoketolase gene, respectively. The gene exhibits an identity of >52% with phosphoketolases of other LAB. The phosphoketolase of Lb. paraplantarum C7(LBPK) contains several highly conserved phosphoketolase signature regions and typical thiamine pyrophosphate(TPP) binding sites, as reported for other TPP-dependent enzymes. The phosphoketolase gene was fused to a glutathione S-transferase(GST::LBPK) gene for purification. The GST::LBPK fusion protein was detected in the soluble fraction of a recombinant Escherichia coli BL21. The GST::LBPK fusion protein was purified with a yield of 4.32mg/400ml by GSTrap HP affinity column chromatography and analyzed by N-terminal sequencing. LBPK was obtained by factor Xa treatment of fusion protein and the final yield was 3.78mg/400ml. LBPK was examined for its N-terminal sequence and phosphoketolase activity. The $K_M\;and\;V_{max}$ values for fructose-6-phosphate were $5.08{\pm}0.057mM(mean{\pm}SD)$ and $499.21{\pm}4.33{\mu}mol/min/mg$, respectively, and the optimum temperature and pH for the production of acetyl phosphate were $45^{\circ}C$ and 7.0, respectively.
기존의 한국어 웹 정보 검색 시스템은 대부분이 불리언 검색 시스템이므로 사용자가 원하는 정보를 한 번의 질의에 의해 얻기가 매우 어렵다. 또한 생략이 빈번하고 링크가 많은 웹 문서의 특성상 기존의 역문헌 빈도에 의한 키워드 선정은 중의성의 문제를 가중시켜 부적절한 키워드가 추출된다. 따라서 원하는 정보를 얻을 때까지 사용자는 질의어의 수정을 반복한다. 본 논문에서는 이러한 문제를 해결하기 위해 연관 피드백(Relevace Feedback) 에이전트 시스템을 설계하고 구현하였다. 연관 피드백 에이전트 시스템은 사용자의 선호 키워드에 대한 적합 문서를 추출하여 선호 키워드를 선호 DB 테이블로 저장하였다가 사용자가 추후에 검색할 때 사용자 질의에 연관 키워드를 추가하여 검색한다. 이 결과로 사용자의 질의 수정의 횟수를 줄이고 검색 효율을 향상시킬 수 있었다.
뫼제비꽃(Viola selkirkii)의 엽록체 DNA 염기서열을 차세대염기서열분석법(NGS)을 이용하여 분석하였다. 재료는 강원도 화천군 일산과 제주도 한라산의 2개체를 사용하였다. 분석결과, 염기서열의 길이는 일산의 뫼제비꽃이 156,774 bp (GC content: 36.30%), 한라산의 뫼제비꽃이 157,451 bp(GC content: 36.30%)로 한라산 개체가 길게 분석되었다. 구간별로 LSC(Large single copy)지역은 한라산 개체(85,950 bp)가 일산 개체(85,930 bp)보다 20 bp 길었으며, SSC(Small single copy)지역은 한라산 개체(17,261 bp)보다 일산 개체가 17,982 bp로 길게 분석되었다. IR(Inverted repeat)지역은 한라산 개체가 27,120 bp로 일산 개체(26,431 bp)보다 길게 분석되었다. 이러한 염기서열 길이의 차이는 종내 개체 간 빈번하게 발생하는 현상으로 IGS와 intron 구간에서 확인 된 단순반복서열의 일부 누락과 IR지역 내의 수축과 확장에 의한 것으로 판단된다. 뫼제비꽃 2개체의 엽록체 게놈을 구성하는 유전자 수는 총 111개로 동일하였으며, protein coding gene 77개, tRNA(transfer RNA) gene 30개, 그리고 rRNA (ribosomal RNA) gene 4개로 구성되어 있었다. 이는 기 발표된 엽록체 DNA 전체 염기서열이 밝혀진 제비꽃속 (Viola) 종류들과 동일한 결과이다.
Park, Nyeong-Soo;Shin, Dong-Woo;Lee, Ke-Ho;Ji, Geun-Eog
Journal of Microbiology and Biotechnology
/
제10권3호
/
pp.312-320
/
2000
Abstract The full sequence of the plasmid pKJ36, which was derived from Bifidobacterium longum KJ, was determined and analyzed to construct shuttle vectors between E. coli and Bifidobacterium. The plasmid pKJ36 was composed of 3,625 base pairs with a 65.1% G+C content. The structural organization of pKJ36 was highly similar to that of pKJ50, and the three major ORFs on pKJ36 showed high amino acid sequence homologies with those of pKJ50. The putative proteins coded by these three ORFs were designated as RepB (32.0 kDa, pI=9.25), MembB (29.0 kDa, pI=12.25), and MobB (39.0 kDa, pI=IO.66), respectively. The amino acid sequence of RepB showed a 57% identity and 70% similarity with that of the RepA protein of pKJ50. Upstream of the repB gene, the so-called iteron sequence was directly repeated four-and-ahalf times and a conserved dnaA box was identified. An amino acid sequence comparison between the MobB and MobA of pKJ50 revealed a 48% identity and 61 % similarity. A conserved oriT sequence with an inverted repeat identical to that of pKJ50 was also found upstream of the mobB gene. A hydropathy analysis of MembB revealed four possible transmembrane regions. The expressions of the repB and membB genes were confirmed by RT-PCR. The in vitro translation reaction of pKJ36 showed protein bands with anticipated sizes with respect to each putative gene product. S 1 endonuclease treatment and Southern hybridization suggested that pKJ36 replicates by a rolling circle mechanism via a single-stranded DNA (ssDNA) intermediate. A shuttle vector between E. coli and Bifidobacterium sp. was constructed using the pKJ36, pBR322, and staphylococcal chloramphenicol acetyl transferase (CAT) gene. The successful transformation of the Bifidobacterium strains was shown by Southern hybridization and PCR. The transformation efficiency differed from strain to strain and, depending on the electroporation conditions, with a range between $1.2{\times}10^1-2.6{\times}10^2{\;}cfu/\mu\textrm{g}$ DNA.X> DNA.
A clinical isolate of Klebsiella pneumoniae K7746 produced the extended-spectrum ${\beta}$-lactamase (ESBL) SHV-12. A 6.6 kb BamHI fragment containing the $bla_{SHV-12}$ gene of K7746 strain was cloned into pCRScriptCAM vector resulting in the recombinant plasmid p7746-Cl. The restriction map of 3.6 kb inserted DNA and sequences immediately surrounding $bla_{SHV-12}$ of p7746-C1 were homologous to plasmid pMPA2a carrying $bla_{SHV-2a}$. In addition, both $bla_{SHV-12}$ and $bla_{SHV-2a}$ were expressed from a common hybrid promoter made of the -35 region derived from the left inverted repeat of IS26 and the -10 region from the $bla_{SHV}$ promoter itself. The results indicate that $bla_{SHV-12}$ and $bla_{SHV-2a}$ may have evolved from a common ancestor in the sequential order of $bla_{SHV-2a}$ first, followed by $bla_{SHV-12}$. Furthermore, by the PCR mapping method using primers corresponding to the IS26 and $bla_{SHV}$, the association between IS26 and $bla_{SHV}$ was studied in 12 clinical isolates carrying $bla_{SHV-2a}$, 27 clinical isolates carrying $bla_{SHV-12}$, and 5 reference strains carrying $bla_{SHV-1}$ to $bla_{SHV-5}$. All 39 strains carrying $bla_{SHV-2a}$ or $bla_{SHV-12}$ were positive by the PCR, providing confirmative evidence that IS26 has been involved in the evolution and dissemination of $bla_{SHV-2a}$ and $bla_{SHV-12}$. But 5 reference strains carrying $bla_{SHV-1}$ to $bla_{SHV-5}$ were negative by the PCR. Therefore, we concluded that the molecular evolutionary pathway of $bla_{SHV-2a}$ and $bla_{SHV-12}$ may be different from that of other $bla_{SHV-ESBL}$, e.g., $bla_{SHV-2}$, $bla_{SHV-3}$, $bla_{SHV-4}$, and $bla_{SHV-5}$.
Jeongjin CHOI;Wonhee KIM;Jee Young PARK;Jong-Soo KANG;Tae-Jin YANG
식물분류학회지
/
제53권1호
/
pp.32-37
/
2023
Spiraea prunifolia f. simpliciflora Nakai is a perennial shrub widely used for horticultural and medicinal purposes. We simultaneously obtained the complete plastid genome (plastome) and nuclear ribosomal gene transcription units, 45S nuclear ribosomal DNA (nrDNA) and 5S nrDNA of S. prunifolia f. simpliciflora, using Illumina short-read data. The plastome is 155,984 bp in length with a canonical quadripartite structure consisting of 84,417 bp of a large single-copy region, 18,887 bp of a short single-copy region, and 26,340 bp of two inverted repeat regions. Overall, a total of 113 genes (79 protein-coding genes, 30 tRNAs, and four rRNAs) were annotated in the plastome. The 45S nrDNA transcription unit is 5,848 bp in length: 1,809 bp, 161 bp, and 3,397 bp for 18S, 5.8S, and 26S, respectively, and 261 bp and 220 bp for internal transcribed spacer (ITS) 1 and ITS 2 regions, respectively. The 5S nrDNA unit is 512 bp, including 121 bp of 5S rRNA and 391 bp of intergenic spacer regions. Phylogenetic analyses showed that the genus Spiraea was monophyletic and sister to the clade of Sibiraea angustata, Petrophytum caespitosum and Kelseya uniflora. Within the genus Spiraea, the sections Calospira and Spiraea were monophyletic, but the sect. Glomerati was nested within the sect. Chamaedryon. In the sect. Glomerati, S. prunifolia f. simpliciflora formed a subclade with S. media, and the subclade was sister to S. thunbergii and S. mongolica. The close relationship between S. prunifolia f. simpliciflora and S. media was also supported by the nrDNA phylogeny, indicating that the plastome and nrDNA sequences assembled in this study belong to the genus Spiraea. The newly reported complete plastome and nrDNA transcription unit sequences of S. prunifolia f. simpliciflora provide useful information for further phylogenetic and evolutionary studies of the genus Spiraea, as well as the family Rosaceae.
갓(Brassica juncea; 2n = 4x = 36, AABB genome, 1,068Mb)은 U's triangle의 배추와 흑겨자 사이의 복이배체 작물로 구분한다. 본 연구는 갓 15 품종의 ribosomal DNA ITS 영역과 MITE를 이용하여 갓의 유연관계 및 품종구분 분자표지를 확인하였다. Ribosomal DNA ITS 영역은 종 및 품종의 유연관계를 알아보는 연구로 많이 사용되고 있어서, 이를 이용하여 갓 15 품종의 유연관계를 알아보았다. 또한, MITE는 매우 많은 copy 수를 가지고 있고, 유전적으로 안정적이기 때문에 유전체 및 진화 연구에 매우 적합한 재료이다. MITE를 이용한 갓의 품종구분 분자표지를 확인하기 위해 MITE super-families 중 Stowaway(BraSto) 관련 70점, Tourist(BraTo) 관련 79점, hAT(BrahAT) 관련 6점, Mutator(BraMu) 관련 5점으로 품종구분 표지를 알아보았다. 총 160점의 분자표지 중 32점이 갓 15 품종에서 뚜렷한 다형성을 보였다. 특히, 흑갓은 표현형뿐만 아니라 유전자형도 매우 다르게 나타났다. 또한 8점의 MITE 분자표지를 활용하여 47점의 유전자원에서 다형성 및 품종구분 표지로의 활용 가능성을 확인하였다. 이러한 다형성 표지들은 갓의 품종구분 및 품종 보호에 매우 유용하게 사용할 수 있을 것이라 기대한다.
본 웹사이트에 게시된 이메일 주소가 전자우편 수집 프로그램이나
그 밖의 기술적 장치를 이용하여 무단으로 수집되는 것을 거부하며,
이를 위반시 정보통신망법에 의해 형사 처벌됨을 유념하시기 바랍니다.
[게시일 2004년 10월 1일]
이용약관
제 1 장 총칙
제 1 조 (목적)
이 이용약관은 KoreaScience 홈페이지(이하 “당 사이트”)에서 제공하는 인터넷 서비스(이하 '서비스')의 가입조건 및 이용에 관한 제반 사항과 기타 필요한 사항을 구체적으로 규정함을 목적으로 합니다.
제 2 조 (용어의 정의)
① "이용자"라 함은 당 사이트에 접속하여 이 약관에 따라 당 사이트가 제공하는 서비스를 받는 회원 및 비회원을
말합니다.
② "회원"이라 함은 서비스를 이용하기 위하여 당 사이트에 개인정보를 제공하여 아이디(ID)와 비밀번호를 부여
받은 자를 말합니다.
③ "회원 아이디(ID)"라 함은 회원의 식별 및 서비스 이용을 위하여 자신이 선정한 문자 및 숫자의 조합을
말합니다.
④ "비밀번호(패스워드)"라 함은 회원이 자신의 비밀보호를 위하여 선정한 문자 및 숫자의 조합을 말합니다.
제 3 조 (이용약관의 효력 및 변경)
① 이 약관은 당 사이트에 게시하거나 기타의 방법으로 회원에게 공지함으로써 효력이 발생합니다.
② 당 사이트는 이 약관을 개정할 경우에 적용일자 및 개정사유를 명시하여 현행 약관과 함께 당 사이트의
초기화면에 그 적용일자 7일 이전부터 적용일자 전일까지 공지합니다. 다만, 회원에게 불리하게 약관내용을
변경하는 경우에는 최소한 30일 이상의 사전 유예기간을 두고 공지합니다. 이 경우 당 사이트는 개정 전
내용과 개정 후 내용을 명확하게 비교하여 이용자가 알기 쉽도록 표시합니다.
제 4 조(약관 외 준칙)
① 이 약관은 당 사이트가 제공하는 서비스에 관한 이용안내와 함께 적용됩니다.
② 이 약관에 명시되지 아니한 사항은 관계법령의 규정이 적용됩니다.
제 2 장 이용계약의 체결
제 5 조 (이용계약의 성립 등)
① 이용계약은 이용고객이 당 사이트가 정한 약관에 「동의합니다」를 선택하고, 당 사이트가 정한
온라인신청양식을 작성하여 서비스 이용을 신청한 후, 당 사이트가 이를 승낙함으로써 성립합니다.
② 제1항의 승낙은 당 사이트가 제공하는 과학기술정보검색, 맞춤정보, 서지정보 등 다른 서비스의 이용승낙을
포함합니다.
제 6 조 (회원가입)
서비스를 이용하고자 하는 고객은 당 사이트에서 정한 회원가입양식에 개인정보를 기재하여 가입을 하여야 합니다.
제 7 조 (개인정보의 보호 및 사용)
당 사이트는 관계법령이 정하는 바에 따라 회원 등록정보를 포함한 회원의 개인정보를 보호하기 위해 노력합니다. 회원 개인정보의 보호 및 사용에 대해서는 관련법령 및 당 사이트의 개인정보 보호정책이 적용됩니다.
제 8 조 (이용 신청의 승낙과 제한)
① 당 사이트는 제6조의 규정에 의한 이용신청고객에 대하여 서비스 이용을 승낙합니다.
② 당 사이트는 아래사항에 해당하는 경우에 대해서 승낙하지 아니 합니다.
- 이용계약 신청서의 내용을 허위로 기재한 경우
- 기타 규정한 제반사항을 위반하며 신청하는 경우
제 9 조 (회원 ID 부여 및 변경 등)
① 당 사이트는 이용고객에 대하여 약관에 정하는 바에 따라 자신이 선정한 회원 ID를 부여합니다.
② 회원 ID는 원칙적으로 변경이 불가하며 부득이한 사유로 인하여 변경 하고자 하는 경우에는 해당 ID를
해지하고 재가입해야 합니다.
③ 기타 회원 개인정보 관리 및 변경 등에 관한 사항은 서비스별 안내에 정하는 바에 의합니다.
제 3 장 계약 당사자의 의무
제 10 조 (KISTI의 의무)
① 당 사이트는 이용고객이 희망한 서비스 제공 개시일에 특별한 사정이 없는 한 서비스를 이용할 수 있도록
하여야 합니다.
② 당 사이트는 개인정보 보호를 위해 보안시스템을 구축하며 개인정보 보호정책을 공시하고 준수합니다.
③ 당 사이트는 회원으로부터 제기되는 의견이나 불만이 정당하다고 객관적으로 인정될 경우에는 적절한 절차를
거쳐 즉시 처리하여야 합니다. 다만, 즉시 처리가 곤란한 경우는 회원에게 그 사유와 처리일정을 통보하여야
합니다.
제 11 조 (회원의 의무)
① 이용자는 회원가입 신청 또는 회원정보 변경 시 실명으로 모든 사항을 사실에 근거하여 작성하여야 하며,
허위 또는 타인의 정보를 등록할 경우 일체의 권리를 주장할 수 없습니다.
② 당 사이트가 관계법령 및 개인정보 보호정책에 의거하여 그 책임을 지는 경우를 제외하고 회원에게 부여된
ID의 비밀번호 관리소홀, 부정사용에 의하여 발생하는 모든 결과에 대한 책임은 회원에게 있습니다.
③ 회원은 당 사이트 및 제 3자의 지적 재산권을 침해해서는 안 됩니다.
제 4 장 서비스의 이용
제 12 조 (서비스 이용 시간)
① 서비스 이용은 당 사이트의 업무상 또는 기술상 특별한 지장이 없는 한 연중무휴, 1일 24시간 운영을
원칙으로 합니다. 단, 당 사이트는 시스템 정기점검, 증설 및 교체를 위해 당 사이트가 정한 날이나 시간에
서비스를 일시 중단할 수 있으며, 예정되어 있는 작업으로 인한 서비스 일시중단은 당 사이트 홈페이지를
통해 사전에 공지합니다.
② 당 사이트는 서비스를 특정범위로 분할하여 각 범위별로 이용가능시간을 별도로 지정할 수 있습니다. 다만
이 경우 그 내용을 공지합니다.
제 13 조 (홈페이지 저작권)
① NDSL에서 제공하는 모든 저작물의 저작권은 원저작자에게 있으며, KISTI는 복제/배포/전송권을 확보하고
있습니다.
② NDSL에서 제공하는 콘텐츠를 상업적 및 기타 영리목적으로 복제/배포/전송할 경우 사전에 KISTI의 허락을
받아야 합니다.
③ NDSL에서 제공하는 콘텐츠를 보도, 비평, 교육, 연구 등을 위하여 정당한 범위 안에서 공정한 관행에
합치되게 인용할 수 있습니다.
④ NDSL에서 제공하는 콘텐츠를 무단 복제, 전송, 배포 기타 저작권법에 위반되는 방법으로 이용할 경우
저작권법 제136조에 따라 5년 이하의 징역 또는 5천만 원 이하의 벌금에 처해질 수 있습니다.
제 14 조 (유료서비스)
① 당 사이트 및 협력기관이 정한 유료서비스(원문복사 등)는 별도로 정해진 바에 따르며, 변경사항은 시행 전에
당 사이트 홈페이지를 통하여 회원에게 공지합니다.
② 유료서비스를 이용하려는 회원은 정해진 요금체계에 따라 요금을 납부해야 합니다.
제 5 장 계약 해지 및 이용 제한
제 15 조 (계약 해지)
회원이 이용계약을 해지하고자 하는 때에는 [가입해지] 메뉴를 이용해 직접 해지해야 합니다.
제 16 조 (서비스 이용제한)
① 당 사이트는 회원이 서비스 이용내용에 있어서 본 약관 제 11조 내용을 위반하거나, 다음 각 호에 해당하는
경우 서비스 이용을 제한할 수 있습니다.
- 2년 이상 서비스를 이용한 적이 없는 경우
- 기타 정상적인 서비스 운영에 방해가 될 경우
② 상기 이용제한 규정에 따라 서비스를 이용하는 회원에게 서비스 이용에 대하여 별도 공지 없이 서비스 이용의
일시정지, 이용계약 해지 할 수 있습니다.
제 17 조 (전자우편주소 수집 금지)
회원은 전자우편주소 추출기 등을 이용하여 전자우편주소를 수집 또는 제3자에게 제공할 수 없습니다.
제 6 장 손해배상 및 기타사항
제 18 조 (손해배상)
당 사이트는 무료로 제공되는 서비스와 관련하여 회원에게 어떠한 손해가 발생하더라도 당 사이트가 고의 또는 과실로 인한 손해발생을 제외하고는 이에 대하여 책임을 부담하지 아니합니다.
제 19 조 (관할 법원)
서비스 이용으로 발생한 분쟁에 대해 소송이 제기되는 경우 민사 소송법상의 관할 법원에 제기합니다.
[부 칙]
1. (시행일) 이 약관은 2016년 9월 5일부터 적용되며, 종전 약관은 본 약관으로 대체되며, 개정된 약관의 적용일 이전 가입자도 개정된 약관의 적용을 받습니다.