• 약학회지
• /
• 제47권5호
• /
• pp.293-299
• /
• 2003

Structure-activity relationship studies of allylamine type of antimycotics were carried out to evaluate the effect of naphthyl and methyl portion of naftifine. Compounds with 4-fluorophenyl(2a-5a), 2-fluorophenyl(2b-5b), 2,4-dichlorophenyl(2c-5c), 2,6-dichlorophenyl(2d-5d), 4-nitrophenyl(2e-5e), and 2,3-dihydro-benzo[1,4]dioxan-6-yl( 2f-5f) instead of naphthyl group with hydrogen(3a-3f), methyl(4a-4f), and ethyl(5a-5f) in the place of methyl in naftifine were synthesized and tested their in vitro anti-fungal activity against five different fungi. Eight compounds(3a, 5a, 3c, 4c, 4d, 5d, 5e, and 4f) showed significant antifungal activity against T. mentagrophytes. (E)-N-Ethyl-(3-phenyl-2-propenyl)-4-nitro-benzenemethaneamine(5e) displayed moderate antifungal activity against all five different fungi.

• 산학경영연구
• /
• 제5권
• /
• pp.241-274
• /
• 1992

General American English(=A.E.) has conservative elements as well as progressive elements. A.E. and B.E. are languages which have more similarities than differances. In this paper. I studied the process of English progress before the A.E. had come into being, and the historical background and the cahristics of A.E. coming into being. Considering the differences between A.E. and B.E. from spelling, pronunciation, vocabulary and grammar, I can give the outline as follows. A spelling 1. B.E. : au, ou $${\rightarrow}$$A.E. : a, o 2. B.E. : e $${\rightarrow}$$A.E. : i 3. B.E. : $${\ae}$$ oe $${\rightarrow}$$A.E. : e 4. B.E. : our $${\rightarrow}$$A.E. : or 5. B.E. : re $${\rightarrow}$$A.E. : er B. pronunciation 1. B.E. : [e] $${\rightarrow}$$A.E. : [i], [e], $$[\partial]$$ 2. B.E. : [a] $${\rightarrow}$$A.E. : 3. B.E. : [i(:)] $${\rightarrow}$$A.E. : [ai], $$[\partial]$$, $$[{\varepsilon}]$$ 4. B.E. : $$[{\ae}]$$ $${\rightarrow}$$A.E. : [e], [c] 5. B.E. : [ai] $${\rightarrow}$$A.E. : $$[{\ae}]$$, [e] 6. B.E. : [c] $${\rightarrow}$$A.E. : [e], [a], [o] 7. In case of "Vowel+[t]+Vowel", [t] is pronounced into [d] or [r] 8. In case of "-nt", [t] becomes a mute. 9. [t]+[j, l, m, n, r, u, or, w] $${\rightarrow}$$A.E. : [?] (=glottal stop) 10. B.E. : [w] $${\rightarrow}$$A.E. : [hw] 11. B.E. : [Voiceless consonants], [Voiced consonants] $${\leftarrow}$$A.E. : [Voiced consonants], [Voiceless consonants] C. Vocabulary The historical background and geographical conditions of those days caused lots of new compounds and neologies. D. Grammar Though we use "of" to indicate the possessive case of inanimate object, -s genitive is used in A.E. In the perfect tense, "have" is often omitted and also auxiliary verb "will" is used in any case

• International Journal of Oral Biology
• /
• 제45권4호
• /
• pp.211-217
• /
• 2020

Molecular mimicry is the most common mechanism that breaches self-tolerance. We previously identified autoantibodies to aquaporin-5 (AQP5) in the sera of patients with Sjögren's syndrome and found that the aquaporin of Prevotella melaninogenica (PmAqp), an oral commensal, is highly homologous to human AQP5. This study aimed to test whether PmAqp can induce anti-AQP5 autoantibodies via molecular mimicry. From the amino acid sequence of PmAqp, an immunizing peptide; i.e., PmE-L, was designed, which contained both the B cell epitope "E" and T cell epitope. C57BL/6 and BALB/c mice were subcutaneously immunized with linear or cyclic forms of PmE-L emulsified in incomplete Freund's adjuvant. The concentrations of the antibodies in sera were measured using enzyme-linked immunosorbent assays. Both linear and cyclic PmE-L induced high levels of antibodies against not only the immunized peptides but also autoantibodies against AQP5E and antibodies against PmE, a Pm homolog of AQP5E. In C57BL/6 mice; however, the cyclic form of PmE-L was more efficient than the linear form in inducing autoantibodies against AQP5E that contained a cyclic epitope. The levels of anti-PmE antibodies and anti-AQP5E autoantibodies showed a strong positive correlation (r = 0.95, p < 0.0005), suggesting molecular mimicry. Collectively, the mice produced anti-AQP5E autoantibodies in response to a PmAqp-derived peptide. This model proved to be useful for studying the mechanisms of autoantibody production by molecular mimicry.

• International Journal of Contents
• /
• 제5권2호
• /
• pp.1-5
• /
• 2009

This study was to analyze important dimensions and its factors of micro level of e-learning determining the quality of e-learning. E-learning dimensions and their factors were identified and developed from the analytical review of related researches. From literature review and survey as well as expert interview, six categories of e-learning identified from this study were: 1) curriculum content, 2) usability, 3) instructional design, 4) evaluation -both process and results, 5) management, and 6) refinement and improvement. A total of thirty-seven factors determining the quality of the e-learning six categories were identified. The rank order and contribution rates for each categories and factors were calculated to explain how importantly they contribute to the quality of e-learning. Also three dimensions such as controlling the e-learning quality, e-learning fundamental dimension e-learning process dimension, and e-learning product dimension, were explained. This study suggests a useful guidance for e-learning quality and evaluation framework for better results.

• Journal of Applied Biological Chemistry
• /
• 제57권2호
• /
• pp.113-122
• /
• 2014

A5E is complex of several medicinal herb ethanol extracts. The aim of this study is investigating the anticancer effect for non-small cell lung cancer. The antitumor effects of A5E on NCI-H460 were examined by regulation of cell proliferation, apoptosis, cell cycle arrest, mitochondrial membrane potential (${\Delta}{\Psi}_m$), and apoptosis-related protein. Cell proliferation was measured by MTS assay. Apoptosis induced by A5E was confirmed by Annexin V-fluorescein isothiocyanate (FITC)/Propidium Iodide (PI) staining, and cell cycle arrest was measured by PI staining. NF-${\kappa}B$ translocation was detected by immunofluorescence and MMP (${\Delta}{\Psi}_m$) was measured by JC-1 staining. The expression of extrinsic pathway molecules such as FasL and FADD were elevated, and procaspase-8 was processed by A5E. In addition, intrinsic pathway related molecules were altered. The Bcl-2 and Bcl-xl levels decreased, Bax increased, and cytochrome C was released. In addition, the mitochondrial membrane potential collapsed, and caspase-3 and poly-(ADP-ribose) polymerase were processed by A5E. Moreover, A5E affected the cellular survival pathway involving phosphatidylinositol 3-kinase (PI3K)/Akt and NF-${\kappa}B$. PI3K and Akt were downregulated, also NF-${\kappa}B$ expression was decreased, and nuclear translocalization was inhibited by A5E. These results suggested that A5E delays proliferation, inhibit cell cycle progression and induce apoptosis in human lung cancer cell. We conclude that A5E is a potential anticancer agent for human lung carcinoma.

• 대한화학회지
• /
• 제35권5호
• /
• pp.575-579
• /
• 1991

6${\beta}$-bromopenicillanic acid(4a)와 p-nitrobenzylbromide, 3-bromophthalide, chloromethylpivalate 및 1-chlorodiethylcarbonate의 반응으로 6${\beta}$-bromopenicillanates(4b~4e)을 합성하였으며, 6${\beta}$-bromopenicillanic acid(4a)와 그의 ester(4b~4e)를 thioglycolic acid와 친핵성 치환반응시켜 새로운 $\beta$-lactam계 화합물인 6-(carboxymethylthio)penicillanic acid(5a)와 그의 ester(5b~5e)를 얻었다.

• Journal of Plant Biology
• /
• 제35권2호
• /
• pp.155-163
• /
• 1992

식물세포에 tumor를 유발하는 Agrobacterium tumefaciens pTiA6 plasmid에서 virE 유전자의 발현조절기작을 분자적수준에서 규명하기 위하여 virE promoter의 5＇-말단을 제거하여 얻은 truncated virE 재조합플라스미드를 이용하여 virE promoter의 조절부위에 대하여 연구하였다. virE promoter의 기능이 존재하는 truncated virE 재조합플라스미드인 pJS201은 전기영동에 의하여 virE promoter의 5＇-말단으로부터 약 130개의 염기가 제거된 것으로 측정되었다. 한편 virE promoter의 기능을 상실한 pJS301에서 dideoxy chain termination방법으로 truncated virE promoter 염기서열을 결정한 결과 263개의 염기가 제거된 것으로 확인되었다. 따라서 virE promoter의 조절부위는 virE promoter의 5＇-말단으로부터 약 130번째의 염기에서 263번째의 염기사이에 존재하는 것으로 사료되며, 이 사이에 23개의 염기로 이루어진 역반복서열(AACTTTGCGCTATAGGCAAAGTT)이 존재하고 있는데, 이 부위가 virE operon의 발현에 있어서 RNA polymerase의 최초 인식부위(recognition site)일 것으로 사료된다.

• 공업화학
• /
• 제20권2호
• /
• pp.134-139
• /
• 2009

(E)-3-(Aryl)acrylaldehyde 유도체들 (1a~1e)과 thiosemicarbazide 축합반응으로 일련의 알릴리덴치오세미카르바존 화합물 (2a~2e)을 45~85%로 얻었다. 이 화합물들을 2,4'-dibromoacetophenone와 2,3-dichloroquinoxaline로 처리하여 각각 2,4-이치환 티아졸류(3a~3e)와 2-[(E)-3-(aryl)allylidenehydrazone]thiazolo[5,4-b]quinoxaline류 (4a~4e)를 좋은 수율로 합성하였다. 새로이 합성한 모든 화합물들의 구조들은 IR과 $^1H-NMR$ 분광학 자료로 확인하였다.

• 대한화학회지
• /
• 제36권4호
• /
• pp.579-583
• /
• 1992

5-Bromo-2-methylpent-2-ene(2)을 출발물질로하여 farnesol인 (2E, 6E)-3,7,11-trimethyldodeca-2,6,10-trien-1-ol(1)의 입체 선택적 합성을 수행하였다. 5-Bromo-2-methylpent-2-ene(2)을 요오드화시킨 후, 5-lithio-2,3-dihydrofuran과 반응시켜 5-(4-methylpent-3-enyl)-2,3-dihydrofuran(4)을 얻었다. Dihydrofuran 4를 MeMgI와 Ni(O)-촉매 짝지음 반응시켜 (3E)-4,8-dimethylnona-3,7-dien-1-ol(5)을 72%의 수율로 얻었다. 알릴알코올 5를 4단계로 거쳐 (5E)-6,10-dimethylundeca-5,9-dien-2-one(8)으로 변환시켰다. 화합물 8을 벤젠 용매하에서 dimethylmethoxycarbonylmethylphosponate와 반응시킨 다음, 에탄올 용매하에서 $NaBH_4$로 환원시켜서 (2E, 6E)-3,7,11-trimethyldodeca-2,6,10-tiren-1-ol(1)을 얻었다. Dihydrofuran 4와 MeMgI와의 Ni(O)-촉매 짝지음 반응이 본 연구의 farnsol(1)의 합성에서 중요한 단계이다.

• Bulletin of the Korean Chemical Society
• /
• 제5권1호
• /
• pp.16-21
• /
• 1984

The relative Arrhenius parameters for t-butoxy radical decomposition (log $A_d$, $E_d$) and hydrogen abstraction of t-butoxy radical from hydrogen donor (log $A_d$, $E_d$) by competitive method were obtained as follows: for cyclohexane; log $A_a/A_d$ = -4.17 mole/l and $E_d-E_a$ = 9.01 kcal/mole, for isobutane; log $A_a/A_d$ = -5.70 mole/l and $E_e-E_a$= 11.0 kcal/mole. From the reported Arrhenius parameters for t-Butoxy radical decomposition reactions the parameters for t-Butoxy radical reactions with isobutane and cyclohexane are estimated to be log $A(l/mol{\cdot}sec)$ = 8.4, $E_a$ = 4.3 kcal/mol and $log A (l/mol{\cdot}sec)= 9.9,\;E_a$ = 6.3 kcal/mol, respectively.