• Title/Summary/Keyword: Clubroot disease

Search Result 64, Processing Time 0.029 seconds

Development of an In Planta Molecular Marker for the Detection of Chinese Cabbage (Brassica campestris ssp. pekinensis) Club Root Pathogen Plasmodiophora brassicae

  • Kim, Hee-Jong;Lee, Youn-Su
    • Journal of Microbiology
    • /
    • v.39 no.1
    • /
    • pp.56-61
    • /
    • 2001
  • Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.

  • PDF

Effects of Temperature, Soil Moisture, Soil pH and Light on Root Gall Development of Chinese Cabbage by Plasmodiophora brassicae (배추무사마귀병 뿌리혹의 형성에 미치는 온도, 토양수분, 토양 pH, 광의 영향)

  • 김충회
    • Plant Disease and Agriculture
    • /
    • v.5 no.2
    • /
    • pp.84-89
    • /
    • 1999
  • Development of root galls of clubroot disease on Chinese cabbage seedlings was first observed 17days after inoculation of Plasmodiophora brassicae at $25^{\circ}C$ 4-11days earlier than at 5, 20, 3$0^{\circ}C$ and 35$^{\circ}C$. Subsequent enlargement of root galls was also fastest at $25^{\circ}C$ and 2$0^{\circ}C$ but delayed at 15$^{\circ}C$ and 3$0^{\circ}C$ or above. Chinese cabbage seedlings with root gall formation showed reduction in number of leaves above ground fresh weight and amount of root hairs but increase in root weight, Root galls development was highest at soil moisture level of 80% of maximum soil moisture capacity than at 60% and 100%. Optimum soil pH for root gall development was pH 6 although root galls were formed at a range of pH 5 to 8. Period of light illumination also affected root gall development with the greatest gall development at 12hr/12hr in light/dark period and the least at 8hr/16hr. Site of root gall formation and gall shape did not differ greatly among treatments of temperature soil moisture pH and light experiments.

  • PDF

New Classification of Plasmodiophora brassicae Races Using Differential Genotypes of Chinese Cabbage

  • Kim, Hun;Choi, Gyung Ja
    • 한국균학회소식:학술대회논문집
    • /
    • 2015.05a
    • /
    • pp.28-28
    • /
    • 2015
  • Clubroot disease caused by Plasmodiophora brassicae induces severe losses of cruciferous vegetables worldwide. To control clubroot of Chinese cabbage, many CR (clubroot resistance) F1 hybrid cultivars have been bred and released in Korea, China and Japan. In this study, we determined the race of P. brassicae 12 field isolates, which collected from 10 regions in Korea, using Williams' differential varieties including two cabbage ('Jersey Queen', 'Badger Shipper') and two rutabaga ('Laurentian', 'Whilhelmsburger'). By Williams' differential varieties, 12 clubroot pathogens were assigned into one (GN2), two (HS and YC), two (HN1 and HN2), three (DJ, KS and SS) and four (GS, GN1, JS and PC) isolates for races 1, 2, 4, 5 and 9, respectively. In addition, the degree of resistance of 45 CR cultivars that were from Korea, China and Japan was tested with the 12 isolates. The 45 CR cultivars of Chinese cabbage were differentiated into three genotypes according to their resistance responses. Even though the 12 P. brassicae isolates were same race by Williams' differential varieties, three CR genotypes showed different resistance response to the isolates. These results indicate that races of P. brassicae by Williams' differentials were not related with resistance of CR cultivars, and three CR genotypes represented qualitative resistance to the P. brassicae isolates. CR genotype I including 'CR-Cheongrok' showed resistance to GN1, GN2, JS, GS, HS, DJ and KS isolates and susceptibility to YC, PC, HN1, HN2 and SS isolates. And CR genotype II such as 'Hangkunjongbyungdaebaekchae' was resistant to GN1, GN2, JS, GS, HS, YC, PC and HN1 and susceptible to DJ, KS, SS and HN2. CR genotype III including 'Chunhajangkun' and 'Akimeki' represented resistance to 10 isolates except for SS and HN2 isolates. Based on these results, we selected 'CR-Cheongrok', 'Hangkunjongbyungdaebaekchae', and 'Chunhajangkun' as a representative cultivar of three CR genotypes and 'Norangkimjang' as a susceptible cultivar. Furthermore, we investigated the resistance of 15 lines of Chinese cabbage, which were provided by seed companies, to 11 isolates except for HN1 of P. brassicae. The results showed that three lines were susceptible to all the tested isolates, whereas five, four, and three lines represented the similar responses corresponding to the CR genotypes I, II, and III, respectively; there is no line of Chinese cabbage showing different resistance patterns compared to three CR genotypes. In particular, line 'SS001' showing resistance responses of CR genotype II was a parent of 'Saerona' that have been commercialized as a CR $F_1$ cultivar of Chinese cabbage. Together, we divided 12 isolates of P. brassicae into 4 races, designated by wild type, mutant type 1, mutant type 2, and mutant type 3. Wild type including GN1, GN2, JS, GS, and HS isolates of P. brassicae was not able to infect all the cultivars of three CR genotypes, whereas, mutant type 3 such as SS and HN2 isolates developed severe clubroot disease on all the CR genotype cultivars. To mutant type 1 including DJ and KS isolates, CR genotypes I, II and III were resistant, susceptible and resistant, respectively. In contrast, to mutant type 2 including YC, PS, and HN1 isolates, CR genotypes I, II and III showed susceptibility, resistance and resistance, respectively. Taken together, our results provide the extended knowledge of classification of P. brassicae races, which is useful information for the breeding of resistant crops, with a suggestion that 'Norangkimjang', 'CR-Cheongrok', 'Saerona' and 'Chunhajangkun' cultivars of Chinese cabbage could be used as new race differentials of P. brassicae for clubroot disease assay.

  • PDF

Distribution of lasmodiophora brassicae Causing clubroot Disease of Chinese Cabbage in Soil (배추무사마귀병균의 토양내 분포)

  • 김충회;조원대;김홍모
    • Research in Plant Disease
    • /
    • v.6 no.1
    • /
    • pp.27-33
    • /
    • 2000
  • Population density of Plasmodiophora brassicae in soil of severely infested fields of Chinese cabbage decreased as soil depth increases. More than 97% of total population was found in surface soil (0-5cm depth), and a few resting spores of the pathogen were also detected in 40 cm-deep soil. the clubroot pathogen was evenly distributed over the surface soil without clustering around a Chinese cabbage plant. Density of P. brassicae in soil at 23 Chinese cabbage fields in Pyongchang, Kangwon province ranged widely from less than 10$^4$resting spores/g soil to above 10$\^$6/ resting spores/g soil. Few or none of P. brassicae was found in virgin soil without any cropping history, intermediate with 0.36-2.75$\times$10$^4$resting spores/g soil in fields of other crops but more than 10 times higher population was found in severely infected Chinese cabbage fields. Density of P. brassicae was highest in the fields of monocropping of crucifers with some exceptions, but was low in rotated fields with corn, rye, medicinal crops or other non-host vegetables. Pathoen density in soil was decreased rapidly when rye or medicinal crops were cultivated after Chinese cabbage, suggesting that survival of clubroot pathogen appears to be influenced greatly by cropping system. The improved method for detecting resting spores of P. brassicae in soil used in this study seemed to be adequate for estimating population density of P. brassicae in soil in aspects of clearer dyeing, increased detecting sensitivity, and simplicity in preparation.

  • PDF

Development of Efficient Screening Method for Resistant Cabbage and Broccoli to Plasmodiophora brassicae (양배추 및 브로콜리 뿌리혹병에 대한 효율적인 저항성 검정 방법 확립)

  • Jo, Su-Jung;Shim, Sun-Ah;Jang, Kyoung-Soo;Choi, Yong-Ho;Kim, Jin-Cheol;Choi, Gyung-Ja
    • Research in Plant Disease
    • /
    • v.18 no.2
    • /
    • pp.86-92
    • /
    • 2012
  • Clubroot caused by Plasmodiophora brassicae Woron. is one of the most important diseases in Brassica crops worldwide. To establish more simple and reliable screening method for resistant cabbage and broccoli to P. brassicae, the development of clubroot on the plants according to inoculum concentration and incubation period after inoculating with the pathogen was investigated using P. brassicae GN1 isolate (race 9). To facilitate and acquire precise result of resistance screening of cabbage and broccoli to clubroot, 14-day-old seedlings were inoculated by drenching roots with the spore suspension of P. brassicae to give inoculum density of $2.5{\times}10^9$ spores/pot. To develop the disease, the inoculated seedlings were incubated in a growth chamber at $20^{\circ}C$ for 3 days, and then cultivated in a greenhouse ($20{\pm}5^{\circ}C$) for five weeks. Under the optimum conditions, 16 cabbage and 17 broccoli cultivars were tested for resistance to four field isolates (GN1, GN2, GS and YC) of P. brassicae collected from four regions in Korea. Among them, some cabbage and broccoli cultivars showed different resistance response to three isolates (GN1, GN2 and GS) determined as race 9 by using the differential varieties of Williams. On the other hand, all the tested cultivars were highly susceptible to YC isolate (race 2). The results suggest that this method is efficient screening method of cabbage and broccoli for resistance to P. brassicae.

Soil-blending Effect of Eggshell Powder on the Control of Club root Disease and the Growth of Chinese Cabbage in the Field (배추 무사마귀병 발병 억제 및 생육증진을 위한 달걀껍질 토양혼화처리 효과)

  • Gao, Yuliang;Kim, Byeong-Kwan;Lim, Tae-Heon;Li, Kui-Hua;Paek, Kee-Yoeup;Cha, Byeong-Jin
    • Research in Plant Disease
    • /
    • v.15 no.2
    • /
    • pp.106-111
    • /
    • 2009
  • Before transplanting Chinese cabbage seedlings, two kinds of eggshell powder were blended into the soil of cabbage field where the club root pathogen, Plasmodiophora brassicae, was infested. The incidence of clubroot disease, the shoot and root growth of cabbages, and soil pH were examined four times at 10 to 13 days interval from transplanting Chinese cabbage. As results, the cabbages treated with eggshell powder without membrane showed the fastest growth in above ground part, and the lowest disease index for clubroot disease. The cabbages treated with eggshell powder with membrane showed better growth than the cabbages of non-treated check, but lower growth than those treated with eggshell powder without membrane. Soil pH started to increase from 3 weeks after soil blending of eggshell powder, and it reached to above 8.0. However, the soil pH of non-treated check stayed at around 6.8. In the experiment to compare the effect of eggshell powder with other calcium compounds, soil-blending of $CaCO_3$ resulted the lowest disease incidence of 1.7 and the registered fungicide, 'flusulfamide', and the resistant variety 'CR Green cabbage' followed with the incidence of 1.9. Cabbages of non-treated check scored the highest disease incidence, 3.4, and that of eggshell powder without membrane was as high as 2.7. However, the growth of Chinese cabbage showed the different pattern to the disease incidence. Chinese cabbages treated with eggshell without membrane recorded the highest average growth, around 2.1 kg. On the other hand, the average growth of CR Green Chinese cabbage was about 2.0 kg, that of flusulfamide-treatment plot was 1.7, and that of non-treated check was as low as 1.3 kg. Soil blending of eggshell powder without membrane did not inhibit the development of clubroot, but increased the growth of cabbage to a great extent. Therefore, it was confirmed that soil blending of eggshell powder before transplanting makes the Chinese cabbage culture possible even in the field infested with club root pathogen.

Development of Convenient Screening Method for Resistant Radish to Plasmodiophora brassicae (효율적인 무 뿌리혹병 저항성 검정법 확립)

  • Jo, Su-Jung;Jang, Kyoung-Soo;Choi, Yong-Ho;Kim, Jin-Cheol;Choi, Gyung-Ja
    • Research in Plant Disease
    • /
    • v.17 no.2
    • /
    • pp.161-168
    • /
    • 2011
  • To establish simple and reliable screening method for resistant radish to Plasmodiophora brassicae Woron. using soil-drenching inoculation, the development of clubroot on radish seedlings inoculated with P. brassicae GN-1 isolate according to several conditions such as inoculum concentration, plant growth stage and incubation period after inoculation was studied. To select resistant radish against clubroot, 10-day-old seedlings were inoculated with P. brassicae by drenching the roots with the spore suspension of the pathogen to give $1{\times}10^9$ spores/pot. The inoculated seedlings were incubated in a growth chamber at $20^{\circ}C$ for 3 days then cultivated in a greenhouse ($20{\pm}5^{\circ}C$) for 6 weeks. Under the optimum conditions, 46 commercial cultivars of radish were tested for resistance to YC-1 (infecting 15 clubroot-resistant cultivars of Chinese cabbage) and GN-1 (wild type) isolates of P. brassicae. Among them, thirty-five cultivars showed resistance to both isolates and one cultivar represented susceptible response to the pathogens. On the other hand, the other cultivars showed different responses against the tested P. brassicae pathogens. The results suggest that this method is an efficient system for screening radish with resistance to clubroot.

Control Efficacy of Flusulfamide GR on Chinese Cabbage Clubroot Caused by Plasmodiophora brassicae (Flusulfamide입제에 의한 배추무사마귀병의 방제효과)

  • Zhang, Xuan-Zhe;Lee, Sun-Uk;Kim, Jeom-Soon;Yoon, Yeo-Sun;Choi, Geun-Suk;Kim, Hak-Ki;Kim, Byung-Sup
    • Research in Plant Disease
    • /
    • v.11 no.1
    • /
    • pp.43-47
    • /
    • 2005
  • To investigate control efficacy of flusulfamide GR (granule) on Chinese cabbage clubroot caused by Plasmodiophora brassicae, experiment was accomplished in field located in Gangneungshi alpine area contaminated by P. brassicae. Flusulfamide GR provided control value of 84.6% and that was statistically significant difference from standard fungicides containing untreated control. To investigate ratio of reduction of resting spore according to fungicide treatment, soil of Chinese cabbage field before and after fungicide treatment were sampled and investigated density of resting spore. Resting spore density was not uniform in soil before fungicide treatment. Therefore, to investigate control efficacy of fungicide against clubroot, investigation on resting spore density was conducted before experiment and reflected in experimental design. Flusulfamide GR and DP (dust powder) provided 64.2% and 63.7% of reduction of resting spore on field soil after fungicide treatments. This result indicated that control efficacy of the fungicides was correlated with reduction of resting spore of P. brassicae. The increasing rate in fresh weight of above-ground part of Chinese cabbage by flusulfamide DP and GR, fluazinam DP and trifloxystrobin SC (suspension concentrate) was 14.3%, 13.0%, 13.8% and 3.8%, respectively. From above result, flusulmide GR have outstanding control efficacy against clubroot of Chinese cabbage and is effectively decreasing of resting spore density in soil.

Effects of Eggshell Powder on Clubroot Disease Control and the Growth of Chinese Cabbage (달걀껍질이 배추의 생육과 무사마귀병 발병억제에 미치는 영향)

  • Kim, Byeong-Kwan;Lim, Tae-Heon;Kim, Youn-Hee;Park, Seok-Hwan;Lee, Sang-Hwa;Cha, Byeong-Jin
    • Research in Plant Disease
    • /
    • v.14 no.3
    • /
    • pp.193-200
    • /
    • 2008
  • Blending of eggshell powder into soil as ratio of 1:5, 1:10, 1:15, 1:20, and 1:25 did not affect seed germination rates of several crops including Chinese cabbage. The blending increased pH of distilled water and decreased the viability of resting spores of Plasmodiophora hrassicae. The ratio of non-viable resting spores in eggshell-blending water was over five times higher than in distilled water of the same pH. Chinese cabbage (cv. 'Norangbom') grew more in eggshell-blended soil than in non-treated soil, but other crops grew less. Leaf numbers and above ground growth of Norangbom increased to around 150% and 470%, respectively, in soil blended with $1:20{\sim}1:15$ of eggshell powder. Even though the optimum sizes of eggshell powder were $0.8{\sim}2.0mm$ for growth and smaller than 0.4 mm for inhibition of clubroot disease of Chinese cabbage, there was no statistical difference among the sizes. Soil pH was above 8.0 in all eggshell treatments without any statistical difference among them. Eggshell powder blending to 1:20 showed lower control efficacy, 58.5%, than registered fungicide 'Hokanna (flusulfamide)', 78.5%. However, Chinese cabbage of that blending ratio recorded the highest growth among the treatments. Therefore, blending of eggshell powder into clubroot-contaminated soil may make culture of Chinese cabbage possible by growth-increasing, even though eggshell powder could not inhibit clubroot disease entirely.

Brief Introduction of Research Progresses in Control and Biocontrol of Clubroot Disease in China

  • He, Yueqiu;Wu, Yixin;He, Pengfei;Li, Xinyu
    • 한국균학회소식:학술대회논문집
    • /
    • 2015.05a
    • /
    • pp.45-46
    • /
    • 2015
  • Clubroot disease of crucifers has occurred since 1957. It has spread to the whole China, especially in the southwest and nourtheast where it causes 30-80% loss in some fields. The disease has being expanded in the recent years as seeds are imported and the floating seedling system practices. For its effective control, the Ministry of Agriculture of China set up a program in 2010 and a research team led by Dr. Yueqiu HE, Yunnan Agricultural University. The team includes 20 main reseachers of 11 universities and 5 institutions. After 5 years, the team has made a lot of progresses in disease occurrence regulation, resources collection, resistance identification and breeding, biological agent exploration, formulation, chemicals evaluation, and control strategy. About 1200 collections of local and commercial crucifers were identified in the field and by artificiall inoculation in the laboratories, 10 resistant cultivars were breeded including 7 Chinese cabbages and 3 cabbages. More than 800 antagostic strains were isolated including bacteria, stretomyces and fungi. Around 100 chemicals were evaluated in the field and greenhouse based on its control effect, among them, 6 showed high control effect, especially fluazinam and cyazofamid could control about 80% the disease. However, fluzinam has negative effect on soil microbes. Clubroot disease could not be controlled by bioagents and chemicals once when the pathogen Plasmodiophora brassicae infected its hosts and set up the parasitic relationship. We found the earlier the pathogent infected its host, the severer the disease was. Therefore, early control was the most effective. For Chinese cabbage, all controlling measures should be taken in the early 30 days because the new infection could not cause severe symptom after 30 days of seeding. For example, a biocontrol agent, Bacillus subtilis Strain XF-1 could control the disease 70%-85% averagely when it mixed with seedling substrate and was drenching 3 times after transplanting, i.e. immediately, 7 days, 14 days. XF-1 has been deeply researched in control mechanisms, its genome, and development and application of biocontrol formulate. It could produce antagonistic protein, enzyme, antibiotics and IAA, which promoted rhizogenesis and growth. Its The genome was sequenced by Illumina/Solexa Genome Analyzer to assembled into 20 scaffolds then the gaps between scaffolds were filled by long fragment PCR amplification to obtain complet genmone with 4,061,186 bp in size. The whole genome was found to have 43.8% GC, 108 tandem repeats with an average of 2.65 copies and 84 transposons. The CDSs were predicted as 3,853 in which 112 CDSs were predicted to secondary metabolite biosynthesis, transport and catabolism. Among those, five NRPS/PKS giant gene clusters being responsible for the biosynthesis of polyketide (pksABCDEFHJLMNRS in size 72.9 kb), surfactin(srfABCD, 26.148 kb, bacilysin(bacABCDE 5.903 kb), bacillibactin(dhbABCEF, 11.774 kb) and fengycin(ppsABCDE, 37.799 kb) have high homolgous to fuction confirmed biosynthesis gene in other strain. Moreover, there are many of key regulatory genes for secondary metabolites from XF-1, such as comABPQKX Z, degQ, sfp, yczE, degU, ycxABCD and ywfG. were also predicted. Therefore, XF-1 has potential of biosynthesis for secondary metabolites surfactin, fengycin, bacillibactin, bacilysin and Bacillaene. Thirty two compounds were detected from cell extracts of XF-1 by MALDI-TOF-MS, including one Macrolactin (m/z 441.06), two fusaricidin (m/z 850.493 and 968.515), one circulocin (m/z 852.509), nine surfactin (m/z 1044.656~1102.652), five iturin (m/z 1096.631~1150.57) and forty fengycin (m/z 1449.79~1543.805). The top three compositions types (contening 56.67% of total extract) are surfactin, iturin and fengycin, in which the most abundant is the surfactin type composition 30.37% of total extract and in second place is the fengycin with 23.28% content with rich diversity of chemical structure, and the smallest one is the iturin with 3.02% content. Moreover, the same main compositions were detected in Bacillus sp.355 which is also a good effects biocontol bacterial for controlling the clubroot of crucifer. Wherefore those compounds surfactin, iturin and fengycin maybe the main active compositions of XF-1 against P. brassicae. Twenty one fengycin type compounds were evaluate by LC-ESI-MS/MS with antifungal activities, including fengycin A $C_{16{\sim}C19}$, fengycin B $C_{14{\sim}C17}$, fengycin C $C_{15{\sim}C18}$, fengycin D $C_{15{\sim}C18}$ and fengycin S $C_{15{\sim}C18}$. Furthermore, one novel compound was identified as Dehydroxyfengycin $C_{17}$ according its MS, 1D and 2D NMR spectral data, which molecular weight is 1488.8480 Da and formula $C_{75}H_{116}N_{12}O_{19}$. The fengycin type compounds (FTCPs $250{\mu}g/mL$) were used to treat the resting spores of P. brassicae ($10^7/mL$) by detecting leakage of the cytoplasm components and cell destruction. After 12 h treatment, the absorbencies at 260 nm (A260) and at 280 nm (A280) increased gradually to approaching the maximum of absorbance, accompanying the collapse of P. brassicae resting spores, and nearly no complete cells were observed at 24 h treatment. The results suggested that the cells could be lyzed by the FTCPs of XF-1, and the diversity of FTCPs was mainly attributed to a mechanism of clubroot disease biocontrol. In the five selected medium MOLP, PSA, LB, Landy and LD, the most suitable for growth of strain medium is MOLP, and the least for strains longevity is the Landy sucrose medium. However, the lipopeptide highest yield is in Landy sucrose medium. The lipopeptides in five medium were analyzed with HPLC, and the results showed that lipopeptides component were same, while their contents from B. subtilis XF-1 fermented in five medium were different. We found that it is the lipopeptides content but ingredients of XF-1 could be impacted by medium and lacking of nutrition seems promoting lipopeptides secretion from XF-1. The volatile components with inhibition fungal Cylindrocarpon spp. activity which were collect in sealed vesel were detected with metheds of HS-SPME-GC-MS in eight biocontrol Bacillus species and four positive mutant strains of XF-1 mutagenized with chemical mutagens, respectively. They have same main volatile components including pyrazine, aldehydes, oxazolidinone and sulfide which are composed of 91.62% in XF-1, in which, the most abundant is the pyrazine type composition with 47.03%, and in second place is the aldehydes with 23.84%, and the third place is oxazolidinone with 15.68%, and the smallest ones is the sulfide with 5.07%.

  • PDF