• Preventive Nutrition and Food Science
• /
• 제18권3호
• /
• pp.218-221
• /
• 2013

Korean cabbage, a member of the Brassicaceae family which also includes cauliflower, mustard, radish, and turnip plants, is a crucial leafy vegetable crop. Korean cabbage is harvested after completion of the leaf heading process and is often prepared for use in "baechu kimchi", a traditional Korean food. Many of the components in Korean cabbage are essential for proper human nutrition; these components can be divided into two groups: primary metabolites, which include carbohydrates, amino acids, fatty acids, and organic acids, and secondary metabolites such as flavonoids, carotenoids, sterols, phenolic acids, alkaloids, and glucosinolates (GSLs). Using gas chromatography-mass spectrometry, this study examined the variety of volatile compounds (including isothiocyanates) contained in Korean cabbage and its seed, which resulted in the identification of 16 and 12 volatile compounds, respectively. The primary volatile compound found in the cabbage was ethyl linoleolate (~23%), while 4,5-epithiovaleronitrile (~46%) was the primary volatile component in the seed.

• Journal of Plant Biology
• /
• 제31권3호
• /
• pp.227-237
• /
• 1988

Effects of putrescine on senescence in detached leaves of Chinese cabbage (Brassica campestris L.) in the light were investigated. The putrescine as a potent antisenescence substane markedly inhibited chlorophyll and protein loss at the 10mM concentraton in the detached leaves during the dark incubation. In the light, however, putrescine showed the opposite effects to dark incubation. The chlorphyll loss by putrescine in the light was stopped with darktransfer, and inhibited competitively by a divalent cation Ca2+. In the light, putrescine reduced the protease activity. Putrescine, in the light, increased H2O2 content and reduced the activities of enzymes -superoxide dismutase (EC 1.15.1.1), peroxidase (EC 1.11.1.7), catalase (EC 1.11.1.6-involved in inhibiting the accumulation of free radicals. These results suggest that the effects of puterscine on chlorophyll and protein loss in detached leaves of Chinese cabbage in the light are related to the cationic nature of putrescine and the accumulation of free radicals.

• 식물병과 농업
• /
• 제5권2호
• /
• pp.105-110
• /
• 1999

Bacterial leaf spot by Xanthomonas campestris pv. vesicatoria has been known to cause serious problem in red pepper in Korea. However recent survey showed that most smptoms in the leaves were mixed with two different symptoms one was leaf spot and the other was canker. bacteria isolated from canker were identified as Clavibacter michiganensis subsp. michiganensis on the basis of biochemical and physiological characteristics. The causal bacteria were non-motile rod-shaped and Gram-positive. The lesions on pepper leaves appeared at first as small blisters or pimple-like white spots which enlarged in size at a later stage. The centers of some of the spots became necrotic and brown and were surrounded by a white halo. Pathogenicity tests were performed on pepper cv. Alchan seedling by spraying of bacterial suspension. During 1997 and 1998 total 17% of 527 fields surveyed were infected by C. michiganensis subsp. michiganensis. The canker of red pepper caused by C. michiganensis subsp. michiganensis was first identified in this study in Korea, and new name "gueyangbyung" was tentatively given to the disease.

• KSBB Journal
• /
• 제17권1호
• /
• pp.26-32
• /
• 2002

세포의 다당류 xanthan을 생산하기 위하여 호기성 박테리아 X. campestris를 9 L 삼상유동층 생물반응기에서 연속적으로 배양하였다. 고점도 배양액에서 공기 기포를 분쇄하기 위하여 직경 8 mm 유리 유동입자를 사용하였다. 반응기 희석률을 증가시킴에 따라 세포 단위질량 당 xanthan 생성속도 및 생성된 xanthan의 분자량은 증가하였다. 산소공급제한이 발생하지 않을 경우 연속발효에서의 xanthan 비생성속도는 회분식 발효에서 제안된 상관식의 예측결과 보다 상당히 높은 값을 보였다.

• Archives of Pharmacal Research
• /
• 제2권1호
• /
• pp.25-33
• /
• 1979

In order to find out nutritional effects of Korean edible mushrooms on the multiplication of tissue cells, the alcohol extracts and acid bydrolysates of eleven species of mushrooms were added to Earle's ESS. A comparison of the respective multiplications of HeLa cells in this solution and in control solution of TC=199. Yielded the following result: The alcohol extracts and acid hydrolysates of a Coprinus comatur, Agaricus campestris, Agaricus bisporus, Lentinus edodes, Tricholoma matsutake, Pleurotus ostretus, Ramaria botrytis and Pholiota nameko influenced favorably the maintenance of the normal form and monolayer of HeLa cells. The growth curves of HeLa cells in the cultures containing, respectively, the alcohol extracts and acid hydrolysates of these eight mushrooms showed that five species, i.e., Coprinus comatus, Agaricus compestris, Agaricus bisporus, Lentinus edodes and Tricholoma matsutake effected an excellent multiplication and that the other three species were less effective than those five species. As to the effects on the cell multiplication, no marked difference was observed between the alcohol extracts and the acid hydrolysates of the mushrooms tested.

• Journal of Plant Biology
• /
• 제32권2호
• /
• pp.109-119
• /
• 1989

Adhatoda vasica Nees is a shrubby component of tropical and subtropical vegetation in Pakistan. t harbours relatively few unhealthy associated species in and around its thickets. Aqueous extracts, rain leachates, litter from shoots and soil underneath it invariably reduced germination, early growth, biomass, moisture and chlorophyll contents of Pennisetum americanum, Setaria italica, Zea mays, Brassica campestris and Triticum vulgare in different laboratory expreiments. chromatographic analysis revealed the presence of caffeic, ferulic, vanillic, p-coumaric, p-OH-benzoic, and tannic acids in aqueous extracts. The phytotoxicity was related to the test species used, part assayed and parameter measured. It is suggested that the preclusion of the associated species and the dominance of A. vasica is primarily due to allelopathy. Negative grazing also provides better chances for its establishment.

• 한국버섯학회지
• /
• 제12권4호
• /
• pp.244-250
• /
• 2014

수집된 주름버섯류의 233점의 phylogenic relationship을 분류하고 자실체형태를 조사하였다. 리보좀 DNA의 ITS 부분의 염기서열을 분석을 통해 38점이 다르게 동정되었다. 수집된 주름버섯의 계통수에서는 양송이와 여름 양송이가 group A 내에서 주름버섯은 group B에서 가까운 유연관계를 보였다. 또한 수집된 국가별 및 양송이내 갓색에 따른 유연관계가 있는 지 알아보았으나, 그 차이는 없었다. 수집된 주름버섯류의 자실체 특성을 조사하기 위해 1차, 2차 두 번 재배를 하였다. 이 결과로 주름버섯류 수집균주의 재배의 유무를 알 수 있었고, 버섯 종류와 시기에 따른 수확량 및 자실체의 특성을 비교를 통해 주름버섯이 2차 재배시 수확량 및 경도에서 우수한 특성을 보이며, 양송이 중에는 비백색양송이가 단단하다는 것을 알 수 있었다. 또한, 여름양송이의 초발이 소요일수와 갈색양송이의 갓 색이 외부환경에 영향을 받는 다는 것을 보여주었다.

• Current Research on Agriculture and Life Sciences
• /
• 제12권
• /
• pp.23-28
• /
• 1994

감미종 고추에 더뎅이병(病)에 대한 저항성(抵抗性)을 도입하기 위하여 품질이 우수하면서 국내 적응성이 뛰어난 피만계 품종 Keystone Resistant Giant #3과 더뎅이병에 저항성인 PI271322를 교배하여 그 후대의 유전적 분리 양상을 조사한 결과 더뎅이병균 race 1에 대하여는 저항성(抵抗性)이 과민형반응(過敏型反應)으로 나타났으며 여기에는 한개의 우성유전자가 관여하는 것으로 밝혀졌다. race 3에 대해서는 발병정도가 연속적(連續的) 변이(變異)를 나타내어 저항성은 양적유전(量的遺傳)을 하는 것으로 나타났다. $F_2$ 집단에서 비과민형반응을 나타내는 개체간의 race 1에 대한 발병지수(發病指數)와 race 3에 대한 발병지수 간에는 고도(高度)의 상관관계(相關關係)가 있는 것으로 나타나 PI271322에 들어 있는 비과민형의 일반저항성 성분은 race에 비특이적으로 작용하는 것으로 나타났다. 따라서 $BC_1$에서 race 1에 과민형반응을 나타내고 race 3에 저항성인 개체를 선발하여 여교잡(戾交雜)육종을 계속할 수 있었다.

• 한국식품영양과학회지
• /
• 제38권10호
• /
• pp.1302-1309
• /
• 2009

순무 싹의 생리활성 기능과 이용 가능성에 관한 연구의 일환으로 순무 싹의 영양성분 및 생리활성 효능을 검증하여 측정한 결과는 다음과 같다. 순무 싹 분말의 일반성분은 건물(dry basis)을 기준으로 수분함량은 2.35%, 조단백질 22.51%, 조지방 21.60%, 조회분 4.35% 및 탄수화물 49.19%를 함유하였다. 구성당은 glucose가 73.39 mg/L로 가장 많았고, fructose가 12.62 mg/L 검출되어 총 2종이 검출되었다. 아미노산은 glutamic acid 함량이 242.57 mg%로 가장 많이 함유되었고, 다음으로 leucine, aspartic acid, valine 순이었다. 순무 싹의 구성 지방산 중 포화지방산 함량은 tricosanoic acid가 가장 높았으며 heneicosanoic acid, palmitic acid 순으로 나타났다. 불포화지방산은 linoleic acid가 가장 높았으며 oleic acid, linolenic acid 순으로 나타났다. 유기산은 총 2종의 유기산이 검출되었으며, tartaric acid 함량이 2,962.74 mg/L로 가장 높았고 다음으로 malic acid 순이었다. 비타민 A와 E의 함량은 각각 0.09 mg%와 3.06 mg%이었다. 무기질은 총 8종의 성분이 검출되었고, 이중 K 함량이 가장 많았으며, 다음으로 Mg, Ca, Na 순이었고 Fe, Zn, Mn, Cu의 함량은 미량이었다. 순무 싹 에탄올 추출물의 기능성을 측정한 결과 순무 싹 에탄올 추출물 100 ${\mu}g$/mL 농도에서 35.24%의 HMG-CoA reductase 저해활성을 나타내었다. 또한 항산화 활성은 시료의 농도가 1,000 ${\mu}g$/mL일 때 아질산염 소거능 및 DPPH radical 소거능이 각각 64.25% 및 69.29%로 매우 높은 항산화 활성을 나타내었다. 이상의 결과 순무 싹 분말은 필수아미노산을 비롯한 항산화 비타민과 무기질을 다량 함유하고 있으며 순무 싹 에탄올 추출물은 HMG-CoA reductase 저해활성 및 항산화 활성이 우수한 것으로 나타나 순무 싹을 이용한 기능성식품의 개발가치가 한층 더 높아질 것으로 기대되어진다.

• Journal of Microbiology
• /
• 제39권1호
• /
• pp.56-61
• /
• 2001

Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.