미국과 영국에서는 교실의 적정한 음환경을 제공하기 위하여 잔향시간 및 배경소음에 대한 기준이 수립되어 있다. 또한 이를 실현하기 위한 건축계획방법 및 실내마감재 적용에 대한 가이드라인을 제시하고 있다. 그러나 대한민국의 경우 학교 교실의 배경소음 기준을 만족하기 위한 가이드라인이 부족할 뿐만 아니라 이에 기초가 되는 교실 벽체의 차음성능에 대한 실태조사가 부족한 실정이다. 본 연구에서는 학교 교실의 실내외 소음에 대한 차음성능을 조사하기 위하여 대한민국 청주시 소재 중학교 2개소의 외부벽체와 실간벽체의 구조를 조사하였다. 실내외 벽체의 차음성능 및 측로전달소음을 비교분석하기 위하여 투과손실, 가중 표준화 음압레벨차, 음향 감쇠 계수, 신호대잡음비 등을 측정하였다. 연구결과 실간벽체의 경우 건식벽으로 건립된 학교의 차음성능이 습식벽보다 높게 나타났으며, 특히 중고파수대역에서 높은 차음성능을 나타내었다. 외부벽체의 경우 각 학교 별로 차음성능을 비교하였을 때 단창을 이중으로 배치한 학교보다 복층유리를 사용한 학교의 성능이 더 높은 것으로 나타났다. 또한 측로전달소음의 경우 창문을 모두 개방하거나 복도 측 창문과 문을 연 경우 기준을 초과하는 것으로 나타나 내부 소음에 의해 학생이 음성전달에 방해를 받을 수 있음을 알 수 있었다.
Borghini, Silvia;Bachetti, Tiziana;Fava, Monica;Duca, Marco Di;Ravazzolo, Roberto;Ceccherini, Isabella
BMB Reports
/
제42권12호
/
pp.788-793
/
2009
TLX2 is an orphan homeodomain transcription factor whose expression is mainly associated with tissues derived from neural crest cells. Recently, we have demonstrated that PHOX2A and PHOX2B are able to enhance the neural cell-type specific expression of human TLX2 by binding distally the 5' -flanking region. In the present work, to deepen into the TLX2 transcription regulation, we have focused on the proximal 5'-flanking region of the gene, mapping the transcription start site and identifying a minimal promoter necessary and sufficient for the basal transcription in cell lines from different origin. Site-directed mutagenesis has allowed to demonstrate that the integrity of this sequence is crucial for gene expression, while electrophoretic mobility shift assays and chromatin immunoprecipitation experiments have revealed that such an activity is dependent on the binding of a PBX factor. Consistent with these findings, such a basal promoter activity has resulted to be enhanced by the previously reported PHOX2-responding sequence.
CYP2E1 in the liver has been studied intensively because it is involved in the metabolic activation of xenobiotics. It is inducible by alcohol, so it has been suspected as the cause of cancer in the stomach and lung. The possible role of CYP2E1 has been suggested strongly as causing tissue damage in mice with renal failure. It was also suspected that 5'-flanking region of CYP2E1 gene might be involved with renal failure. So, we investigated polymorphism of restriction enzyme sites within CYP2E1 gene using the PCR-RFLP analysis. PstI and RsaI sites were located at 5'-flanking region and DraI site was located at intron 6. All three types (W/W, W/S, S/S) were observed for these enzymes although each incidence was somewhat different depending the enzyme sites. W/W was prominent for PstI whereas W/S was markedly high for RsaI. Overall, polymorphic incidence in patients was somewhat higher than normal population. This research should facilitate further investigation of CYP2E1 at genetic level as the direct cause of tissue damage in various organs.
Calmodulin 유전자의 발현 조절을 연구하기 위해, 벼 calmodulin promoter (RCaM-2)를 분리하여 GUS (report 유전자)에 융합하였다. GUS 활성은 정단조직, 근단 및 관다발 영역과 같은 성장조직에서 높게 발현되었다. 줄기와 페티올의 transverse 절단부위 GUS 활성은 관다발계의 안쪽에 제한되었으며 관다발계의 외부에 위치한 피층과 표피에서는 강하게 발현된 식물에서도 GUS 활성이 나타나지 않았다. GUS 활성은 어린 조직에서 특이적으로 발현되었으며 상처에 의해서 신속하게 증가하였다. RCaM-2 promoter는 세포분열이 왕성한 어린조직이나 생장점에서 강하게 발현되며 mechanical 신호에 의해서 현저히 유도되었다. 이러한 결과는 RCaM-2 유전자의 5'-flanking 영역이 상처에 의해서 유도되는 발현을 조절하는 것으로 추정된다.
With the continual development of genetically modified (GM) crops, it has become necessary to develop detailed and effective molecular characterization methods to select candidate events from a large pool of transformation events. Relative to traditional molecular analysis methods such as the polymerase chain reaction (PCR) and Southern blot hybridization, next generation sequencing (NGS) technology for whole-genome sequencing of complex crop genomes had proven comparatively useful for in-depth molecular characterization. In this study, four transformation events, including one in Bacillus thuringiensis (Bt)-resistant rice, one in resveratrol-producing rice, and two in beta-carotene-enhanced soybeans, were selected for molecular characterization. To merge NGS analysis and Southern blot-hybridization results, we confirmed the transgene insertion sites, insertion construction, and insertion numbers of these four transformation events. In addition, the read-coverage depth assessed by NGS analysis for inserted genes might provide consistent results in terms of inserted T-DNA numbers in case of complex insertion structures and highly duplicated donor genomes; however, PCR-based methods can produce incorrect conclusions. Our combined method provides an effective and complete analytical approach for whole-genome visual inspection of transformation events that require biosafety assessment.
Saccharomyces cerevisiae HIS 5 유전자는 histidinol phosphate aminotransferase (EC: 2, 6, 1,9)를 code하는 아미노산 합성유전자이다. 이 유전자는 plasmid pSH 530에 cloning되어 E. coli와 Saccharomyces cerevisiae 숙주에서 promoter로서 전사하였다. HIS 5 유전자의 총염기 수는 736개이였고 5' 상류영역에는 긴 reading frame, directed repeat, 전사개시점, 그리고 Pribnow box염기배열이 있었다. 특히 HIS 5 유전자의 ATG 주변 염기배열은 -A-A-A-T-T-A-C-A-C-T-A-T-G-G-T-T-T-T-T-G-A-T-였으며 C block은 없었다.
In a previous paper (Kim et al., 1996a), the immediate 5' -flanking region and coding region of the human UDP-N -acetylglucosamine:-D-mannoside-1,4-Nacetylglucosaminyltransferase III (N-acetylglucosaminyitransferase- III; GnT-III) gene was reported, isolated and analyzed. Herein, we report on amplification of a new 5' -noncoding region of the GnT-III mRNA by single-strand ligation to single-stranded cDNA-PCR (5' -RACE PCR) using poly(A)+ RNA isolated from human fetal liver cells. A cDNA clone was obtained with 5' sequences (96 bp) that diverged seven nucleotides upstream from the ATG (+1) start codon. A concensus splice junction sequence, TCTCCCGCAG, was found immediately 5' to the position where the sequences of the cDNA diverged. The result suggested the presence of an intron in the 5' -noncoding region and that the cDNA was an incompletely reversetranscribed cDNA product derived from an mRNA containing a new noncoding exon. When mRNA expression of GnT-III in various human tissues and cancer cell lines was examined, Northern blot analysis indicated high expression levels of GnT-III in human fetal kidney and brain tissues, as well as for a number of leukemia and lymphoma cancer cell lines. Promoter activities of the 5' -flanking regions of exon 1 and the new noncoding region were measured in a human hepatoma cell line, HepG2, by luciferase assays. The 5'-flanking region of exon 1 was the most active, whilst that of exon 2 was inactive.
Park, Jaehyuk;Cho, Dong Youn;Moon, Jin Seong;Yoon, Moo-Kyoung;Kim, Sunggil
원예과학기술지
/
제31권1호
/
pp.72-79
/
2013
Inactivation of the gene coding for dihydroflavonol 4-reductase (DFR) is responsible for the color difference between red and yellow onions (Allium cepa L.). Two inactive DFR-A alleles, DFR-$A^{PS}$ and DFR-$A^{DEL}$, were identified in our previous study. A functional marker was developed on the basis of the premature stop codon that inactivated the DFR-$A^{PS}$ allele. A derived cleaved amplified polymorphic sequences (dCAPS) primer was designed to detect the single nucleotide polymorphism, an A/T transition, which produced the premature stop codon. Digested PCR products clearly distinguished the homozygous and heterozygous red $F_2$ individuals. Meanwhile, to develop a molecular marker for detection of the DFR-$A^{DEL}$ allele in which entire DFR-A gene was deleted, genome walking was performed and approximately 3 kb 5' and 3' flanking sequences of the DFR-$A^R$ coding region were obtained. PCR amplification using multiple primers binding to the extended flanking regions showed that more of the extended region of the DFR-A gene was deleted in the DFR-$A^{DEL}$ allele. A dominant simple PCR marker was developed to identify the DFR-$A^{DEL}$ allele using the dissimilar 3' flanking sequences of the DFR-A gene and homologous DFR-B pseudogene. Distribution of the DFR-$A^{PS}$ and DFR-$A^{DEL}$ alleles in yellow onion cultivars bred in Korea and Japan was surveyed using molecular makers developed in this study. Results showed predominant existence of the DFR-$A^{PS}$ allele in yellow onion cultivars.
One clone(pANt32) carring tRNA/sup Arg/ gene was selected from Aspergillus total tRNA gene clones. The nucleotide sequences of this tRNA gene were determined by Maxam and Gilbert's chemical cleavage methods. The sequence of this tRNA gene is as follow; 5'GGCCGGCTGCCCAATTGGCAAGGCGTCTGACTACGAATCAGGAGAT TGCAGGTTCGAGCCCTGCGTGGGTCA3'. This sequence conicides with the characteristecs of other eukaryotic tRNA. Some consensus sequences (ACT-TA bow, TATTTT and T-cluster) are found in both 5'-end and 3'-end flanking regions.
본 웹사이트에 게시된 이메일 주소가 전자우편 수집 프로그램이나
그 밖의 기술적 장치를 이용하여 무단으로 수집되는 것을 거부하며,
이를 위반시 정보통신망법에 의해 형사 처벌됨을 유념하시기 바랍니다.
[게시일 2004년 10월 1일]
이용약관
제 1 장 총칙
제 1 조 (목적)
이 이용약관은 KoreaScience 홈페이지(이하 “당 사이트”)에서 제공하는 인터넷 서비스(이하 '서비스')의 가입조건 및 이용에 관한 제반 사항과 기타 필요한 사항을 구체적으로 규정함을 목적으로 합니다.
제 2 조 (용어의 정의)
① "이용자"라 함은 당 사이트에 접속하여 이 약관에 따라 당 사이트가 제공하는 서비스를 받는 회원 및 비회원을
말합니다.
② "회원"이라 함은 서비스를 이용하기 위하여 당 사이트에 개인정보를 제공하여 아이디(ID)와 비밀번호를 부여
받은 자를 말합니다.
③ "회원 아이디(ID)"라 함은 회원의 식별 및 서비스 이용을 위하여 자신이 선정한 문자 및 숫자의 조합을
말합니다.
④ "비밀번호(패스워드)"라 함은 회원이 자신의 비밀보호를 위하여 선정한 문자 및 숫자의 조합을 말합니다.
제 3 조 (이용약관의 효력 및 변경)
① 이 약관은 당 사이트에 게시하거나 기타의 방법으로 회원에게 공지함으로써 효력이 발생합니다.
② 당 사이트는 이 약관을 개정할 경우에 적용일자 및 개정사유를 명시하여 현행 약관과 함께 당 사이트의
초기화면에 그 적용일자 7일 이전부터 적용일자 전일까지 공지합니다. 다만, 회원에게 불리하게 약관내용을
변경하는 경우에는 최소한 30일 이상의 사전 유예기간을 두고 공지합니다. 이 경우 당 사이트는 개정 전
내용과 개정 후 내용을 명확하게 비교하여 이용자가 알기 쉽도록 표시합니다.
제 4 조(약관 외 준칙)
① 이 약관은 당 사이트가 제공하는 서비스에 관한 이용안내와 함께 적용됩니다.
② 이 약관에 명시되지 아니한 사항은 관계법령의 규정이 적용됩니다.
제 2 장 이용계약의 체결
제 5 조 (이용계약의 성립 등)
① 이용계약은 이용고객이 당 사이트가 정한 약관에 「동의합니다」를 선택하고, 당 사이트가 정한
온라인신청양식을 작성하여 서비스 이용을 신청한 후, 당 사이트가 이를 승낙함으로써 성립합니다.
② 제1항의 승낙은 당 사이트가 제공하는 과학기술정보검색, 맞춤정보, 서지정보 등 다른 서비스의 이용승낙을
포함합니다.
제 6 조 (회원가입)
서비스를 이용하고자 하는 고객은 당 사이트에서 정한 회원가입양식에 개인정보를 기재하여 가입을 하여야 합니다.
제 7 조 (개인정보의 보호 및 사용)
당 사이트는 관계법령이 정하는 바에 따라 회원 등록정보를 포함한 회원의 개인정보를 보호하기 위해 노력합니다. 회원 개인정보의 보호 및 사용에 대해서는 관련법령 및 당 사이트의 개인정보 보호정책이 적용됩니다.
제 8 조 (이용 신청의 승낙과 제한)
① 당 사이트는 제6조의 규정에 의한 이용신청고객에 대하여 서비스 이용을 승낙합니다.
② 당 사이트는 아래사항에 해당하는 경우에 대해서 승낙하지 아니 합니다.
- 이용계약 신청서의 내용을 허위로 기재한 경우
- 기타 규정한 제반사항을 위반하며 신청하는 경우
제 9 조 (회원 ID 부여 및 변경 등)
① 당 사이트는 이용고객에 대하여 약관에 정하는 바에 따라 자신이 선정한 회원 ID를 부여합니다.
② 회원 ID는 원칙적으로 변경이 불가하며 부득이한 사유로 인하여 변경 하고자 하는 경우에는 해당 ID를
해지하고 재가입해야 합니다.
③ 기타 회원 개인정보 관리 및 변경 등에 관한 사항은 서비스별 안내에 정하는 바에 의합니다.
제 3 장 계약 당사자의 의무
제 10 조 (KISTI의 의무)
① 당 사이트는 이용고객이 희망한 서비스 제공 개시일에 특별한 사정이 없는 한 서비스를 이용할 수 있도록
하여야 합니다.
② 당 사이트는 개인정보 보호를 위해 보안시스템을 구축하며 개인정보 보호정책을 공시하고 준수합니다.
③ 당 사이트는 회원으로부터 제기되는 의견이나 불만이 정당하다고 객관적으로 인정될 경우에는 적절한 절차를
거쳐 즉시 처리하여야 합니다. 다만, 즉시 처리가 곤란한 경우는 회원에게 그 사유와 처리일정을 통보하여야
합니다.
제 11 조 (회원의 의무)
① 이용자는 회원가입 신청 또는 회원정보 변경 시 실명으로 모든 사항을 사실에 근거하여 작성하여야 하며,
허위 또는 타인의 정보를 등록할 경우 일체의 권리를 주장할 수 없습니다.
② 당 사이트가 관계법령 및 개인정보 보호정책에 의거하여 그 책임을 지는 경우를 제외하고 회원에게 부여된
ID의 비밀번호 관리소홀, 부정사용에 의하여 발생하는 모든 결과에 대한 책임은 회원에게 있습니다.
③ 회원은 당 사이트 및 제 3자의 지적 재산권을 침해해서는 안 됩니다.
제 4 장 서비스의 이용
제 12 조 (서비스 이용 시간)
① 서비스 이용은 당 사이트의 업무상 또는 기술상 특별한 지장이 없는 한 연중무휴, 1일 24시간 운영을
원칙으로 합니다. 단, 당 사이트는 시스템 정기점검, 증설 및 교체를 위해 당 사이트가 정한 날이나 시간에
서비스를 일시 중단할 수 있으며, 예정되어 있는 작업으로 인한 서비스 일시중단은 당 사이트 홈페이지를
통해 사전에 공지합니다.
② 당 사이트는 서비스를 특정범위로 분할하여 각 범위별로 이용가능시간을 별도로 지정할 수 있습니다. 다만
이 경우 그 내용을 공지합니다.
제 13 조 (홈페이지 저작권)
① NDSL에서 제공하는 모든 저작물의 저작권은 원저작자에게 있으며, KISTI는 복제/배포/전송권을 확보하고
있습니다.
② NDSL에서 제공하는 콘텐츠를 상업적 및 기타 영리목적으로 복제/배포/전송할 경우 사전에 KISTI의 허락을
받아야 합니다.
③ NDSL에서 제공하는 콘텐츠를 보도, 비평, 교육, 연구 등을 위하여 정당한 범위 안에서 공정한 관행에
합치되게 인용할 수 있습니다.
④ NDSL에서 제공하는 콘텐츠를 무단 복제, 전송, 배포 기타 저작권법에 위반되는 방법으로 이용할 경우
저작권법 제136조에 따라 5년 이하의 징역 또는 5천만 원 이하의 벌금에 처해질 수 있습니다.
제 14 조 (유료서비스)
① 당 사이트 및 협력기관이 정한 유료서비스(원문복사 등)는 별도로 정해진 바에 따르며, 변경사항은 시행 전에
당 사이트 홈페이지를 통하여 회원에게 공지합니다.
② 유료서비스를 이용하려는 회원은 정해진 요금체계에 따라 요금을 납부해야 합니다.
제 5 장 계약 해지 및 이용 제한
제 15 조 (계약 해지)
회원이 이용계약을 해지하고자 하는 때에는 [가입해지] 메뉴를 이용해 직접 해지해야 합니다.
제 16 조 (서비스 이용제한)
① 당 사이트는 회원이 서비스 이용내용에 있어서 본 약관 제 11조 내용을 위반하거나, 다음 각 호에 해당하는
경우 서비스 이용을 제한할 수 있습니다.
- 2년 이상 서비스를 이용한 적이 없는 경우
- 기타 정상적인 서비스 운영에 방해가 될 경우
② 상기 이용제한 규정에 따라 서비스를 이용하는 회원에게 서비스 이용에 대하여 별도 공지 없이 서비스 이용의
일시정지, 이용계약 해지 할 수 있습니다.
제 17 조 (전자우편주소 수집 금지)
회원은 전자우편주소 추출기 등을 이용하여 전자우편주소를 수집 또는 제3자에게 제공할 수 없습니다.
제 6 장 손해배상 및 기타사항
제 18 조 (손해배상)
당 사이트는 무료로 제공되는 서비스와 관련하여 회원에게 어떠한 손해가 발생하더라도 당 사이트가 고의 또는 과실로 인한 손해발생을 제외하고는 이에 대하여 책임을 부담하지 아니합니다.
제 19 조 (관할 법원)
서비스 이용으로 발생한 분쟁에 대해 소송이 제기되는 경우 민사 소송법상의 관할 법원에 제기합니다.
[부 칙]
1. (시행일) 이 약관은 2016년 9월 5일부터 적용되며, 종전 약관은 본 약관으로 대체되며, 개정된 약관의 적용일 이전 가입자도 개정된 약관의 적용을 받습니다.