• 한국동물학회:학술대회논문집
• /
• 한국동물학회 2001년도 한국생물과학협회 학술발표대회
• /
• pp.231.2-231
• /
• 2001

No Abstract, See Full Text

• 한국음향학회지
• /
• 제36권5호
• /
• pp.329-337
• /
• 2017

미국과 영국에서는 교실의 적정한 음환경을 제공하기 위하여 잔향시간 및 배경소음에 대한 기준이 수립되어 있다. 또한 이를 실현하기 위한 건축계획방법 및 실내마감재 적용에 대한 가이드라인을 제시하고 있다. 그러나 대한민국의 경우 학교 교실의 배경소음 기준을 만족하기 위한 가이드라인이 부족할 뿐만 아니라 이에 기초가 되는 교실 벽체의 차음성능에 대한 실태조사가 부족한 실정이다. 본 연구에서는 학교 교실의 실내외 소음에 대한 차음성능을 조사하기 위하여 대한민국 청주시 소재 중학교 2개소의 외부벽체와 실간벽체의 구조를 조사하였다. 실내외 벽체의 차음성능 및 측로전달소음을 비교분석하기 위하여 투과손실, 가중 표준화 음압레벨차, 음향 감쇠 계수, 신호대잡음비 등을 측정하였다. 연구결과 실간벽체의 경우 건식벽으로 건립된 학교의 차음성능이 습식벽보다 높게 나타났으며, 특히 중고파수대역에서 높은 차음성능을 나타내었다. 외부벽체의 경우 각 학교 별로 차음성능을 비교하였을 때 단창을 이중으로 배치한 학교보다 복층유리를 사용한 학교의 성능이 더 높은 것으로 나타났다. 또한 측로전달소음의 경우 창문을 모두 개방하거나 복도 측 창문과 문을 연 경우 기준을 초과하는 것으로 나타나 내부 소음에 의해 학생이 음성전달에 방해를 받을 수 있음을 알 수 있었다.

• BMB Reports
• /
• 제42권12호
• /
• pp.788-793
• /
• 2009

TLX2 is an orphan homeodomain transcription factor whose expression is mainly associated with tissues derived from neural crest cells. Recently, we have demonstrated that PHOX2A and PHOX2B are able to enhance the neural cell-type specific expression of human TLX2 by binding distally the 5' -flanking region. In the present work, to deepen into the TLX2 transcription regulation, we have focused on the proximal 5'-flanking region of the gene, mapping the transcription start site and identifying a minimal promoter necessary and sufficient for the basal transcription in cell lines from different origin. Site-directed mutagenesis has allowed to demonstrate that the integrity of this sequence is crucial for gene expression, while electrophoretic mobility shift assays and chromatin immunoprecipitation experiments have revealed that such an activity is dependent on the binding of a PBX factor. Consistent with these findings, such a basal promoter activity has resulted to be enhanced by the previously reported PHOX2-responding sequence.

• 대한의생명과학회지
• /
• 제19권4호
• /
• pp.310-314
• /
• 2013

CYP2E1 in the liver has been studied intensively because it is involved in the metabolic activation of xenobiotics. It is inducible by alcohol, so it has been suspected as the cause of cancer in the stomach and lung. The possible role of CYP2E1 has been suggested strongly as causing tissue damage in mice with renal failure. It was also suspected that 5'-flanking region of CYP2E1 gene might be involved with renal failure. So, we investigated polymorphism of restriction enzyme sites within CYP2E1 gene using the PCR-RFLP analysis. PstI and RsaI sites were located at 5'-flanking region and DraI site was located at intron 6. All three types (W/W, W/S, S/S) were observed for these enzymes although each incidence was somewhat different depending the enzyme sites. W/W was prominent for PstI whereas W/S was markedly high for RsaI. Overall, polymorphic incidence in patients was somewhat higher than normal population. This research should facilitate further investigation of CYP2E1 at genetic level as the direct cause of tissue damage in various organs.

• 생명과학회지
• /
• 제15권2호
• /
• pp.176-181
• /
• 2005

Calmodulin 유전자의 발현 조절을 연구하기 위해, 벼 calmodulin promoter (RCaM-2)를 분리하여 GUS (report 유전자)에 융합하였다. GUS 활성은 정단조직, 근단 및 관다발 영역과 같은 성장조직에서 높게 발현되었다. 줄기와 페티올의 transverse 절단부위 GUS 활성은 관다발계의 안쪽에 제한되었으며 관다발계의 외부에 위치한 피층과 표피에서는 강하게 발현된 식물에서도 GUS 활성이 나타나지 않았다. GUS 활성은 어린 조직에서 특이적으로 발현되었으며 상처에 의해서 신속하게 증가하였다. RCaM-2 promoter는 세포분열이 왕성한 어린조직이나 생장점에서 강하게 발현되며 mechanical 신호에 의해서 현저히 유도되었다. 이러한 결과는 RCaM-2 유전자의 5'-flanking 영역이 상처에 의해서 유도되는 발현을 조절하는 것으로 추정된다.

• Plant Breeding and Biotechnology
• /
• 제5권4호
• /
• pp.269-281
• /
• 2017

With the continual development of genetically modified (GM) crops, it has become necessary to develop detailed and effective molecular characterization methods to select candidate events from a large pool of transformation events. Relative to traditional molecular analysis methods such as the polymerase chain reaction (PCR) and Southern blot hybridization, next generation sequencing (NGS) technology for whole-genome sequencing of complex crop genomes had proven comparatively useful for in-depth molecular characterization. In this study, four transformation events, including one in Bacillus thuringiensis (Bt)-resistant rice, one in resveratrol-producing rice, and two in beta-carotene-enhanced soybeans, were selected for molecular characterization. To merge NGS analysis and Southern blot-hybridization results, we confirmed the transgene insertion sites, insertion construction, and insertion numbers of these four transformation events. In addition, the read-coverage depth assessed by NGS analysis for inserted genes might provide consistent results in terms of inserted T-DNA numbers in case of complex insertion structures and highly duplicated donor genomes; however, PCR-based methods can produce incorrect conclusions. Our combined method provides an effective and complete analytical approach for whole-genome visual inspection of transformation events that require biosafety assessment.

• 한국미생물·생명공학회지
• /
• 제13권1호
• /
• pp.19-25
• /
• 1985

Saccharomyces cerevisiae HIS 5 유전자는 histidinol phosphate aminotransferase (EC: 2, 6, 1,9)를 code하는 아미노산 합성유전자이다. 이 유전자는 plasmid pSH 530에 cloning되어 E. coli와 Saccharomyces cerevisiae 숙주에서 promoter로서 전사하였다. HIS 5 유전자의 총염기 수는 736개이였고 5' 상류영역에는 긴 reading frame, directed repeat, 전사개시점, 그리고 Pribnow box염기배열이 있었다. 특히 HIS 5 유전자의 ATG 주변 염기배열은 -A-A-A-T-T-A-C-A-C-T-A-T-G-G-T-T-T-T-T-G-A-T-였으며 C block은 없었다.

• BMB Reports
• /
• 제31권6호
• /
• pp.578-584
• /
• 1998

In a previous paper (Kim et al., 1996a), the immediate 5' -flanking region and coding region of the human UDP-N -acetylglucosamine:-D-mannoside-1,4-Nacetylglucosaminyltransferase III (N-acetylglucosaminyitransferase- III; GnT-III) gene was reported, isolated and analyzed. Herein, we report on amplification of a new 5' -noncoding region of the GnT-III mRNA by single-strand ligation to single-stranded cDNA-PCR (5' -RACE PCR) using poly(A)+ RNA isolated from human fetal liver cells. A cDNA clone was obtained with 5' sequences (96 bp) that diverged seven nucleotides upstream from the ATG (+1) start codon. A concensus splice junction sequence, TCTCCCGCAG, was found immediately 5' to the position where the sequences of the cDNA diverged. The result suggested the presence of an intron in the 5' -noncoding region and that the cDNA was an incompletely reversetranscribed cDNA product derived from an mRNA containing a new noncoding exon. When mRNA expression of GnT-III in various human tissues and cancer cell lines was examined, Northern blot analysis indicated high expression levels of GnT-III in human fetal kidney and brain tissues, as well as for a number of leukemia and lymphoma cancer cell lines. Promoter activities of the 5' -flanking regions of exon 1 and the new noncoding region were measured in a human hepatoma cell line, HepG2, by luciferase assays. The 5'-flanking region of exon 1 was the most active, whilst that of exon 2 was inactive.

• 원예과학기술지
• /
• 제31권1호
• /
• pp.72-79
• /
• 2013

Inactivation of the gene coding for dihydroflavonol 4-reductase (DFR) is responsible for the color difference between red and yellow onions (Allium cepa L.). Two inactive DFR-A alleles, DFR-$A^{PS}$ and DFR-$A^{DEL}$, were identified in our previous study. A functional marker was developed on the basis of the premature stop codon that inactivated the DFR-$A^{PS}$ allele. A derived cleaved amplified polymorphic sequences (dCAPS) primer was designed to detect the single nucleotide polymorphism, an A/T transition, which produced the premature stop codon. Digested PCR products clearly distinguished the homozygous and heterozygous red $F_2$ individuals. Meanwhile, to develop a molecular marker for detection of the DFR-$A^{DEL}$ allele in which entire DFR-A gene was deleted, genome walking was performed and approximately 3 kb 5' and 3' flanking sequences of the DFR-$A^R$ coding region were obtained. PCR amplification using multiple primers binding to the extended flanking regions showed that more of the extended region of the DFR-A gene was deleted in the DFR-$A^{DEL}$ allele. A dominant simple PCR marker was developed to identify the DFR-$A^{DEL}$ allele using the dissimilar 3' flanking sequences of the DFR-A gene and homologous DFR-B pseudogene. Distribution of the DFR-$A^{PS}$ and DFR-$A^{DEL}$ alleles in yellow onion cultivars bred in Korea and Japan was surveyed using molecular makers developed in this study. Results showed predominant existence of the DFR-$A^{PS}$ allele in yellow onion cultivars.

• 미생물학회지
• /
• 제24권3호
• /
• pp.204-210
• /
• 1986

One clone(pANt32) carring tRNA/sup Arg/ gene was selected from Aspergillus total tRNA gene clones. The nucleotide sequences of this tRNA gene were determined by Maxam and Gilbert's chemical cleavage methods. The sequence of this tRNA gene is as follow; 5'GGCCGGCTGCCCAATTGGCAAGGCGTCTGACTACGAATCAGGAGAT TGCAGGTTCGAGCCCTGCGTGGGTCA3'. This sequence conicides with the characteristecs of other eukaryotic tRNA. Some consensus sequences (ACT-TA bow, TATTTT and T-cluster) are found in both 5'-end and 3'-end flanking regions.