• Korean Journal of Microbiology
• /
• v.24 no.2
• /
• pp.79-85
• /
• 1986

We have determined the sequence of $tRNA^{Arg}$ of A. nidulans partially by enzymatic rapid RNA sequencing technique. The sequence was 5'GGCCGGCUGGCCCAAXUGGCAAGGXUCUGAXUACGAAXCAGGAGAUUGCACXXXXXGAGCXXUXXGUCGGUCACCA3' The cloverleaf structure was made from above data. As a result, the anticodon sequence was identified as ACG. This result was confirmed with charging test. The complete sequence was proposed by supplementing the DNA sequence to and by assigning the position of minor bases to this RNA sequence.

• Korean Journal of Microbiology
• /
• v.24 no.3
• /
• pp.204-210
• /
• 1986

One clone(pANt32) carring tRNA/sup Arg/ gene was selected from Aspergillus total tRNA gene clones. The nucleotide sequences of this tRNA gene were determined by Maxam and Gilbert's chemical cleavage methods. The sequence of this tRNA gene is as follow; 5'GGCCGGCTGCCCAATTGGCAAGGCGTCTGACTACGAATCAGGAGAT TGCAGGTTCGAGCCCTGCGTGGGTCA3'. This sequence conicides with the characteristecs of other eukaryotic tRNA. Some consensus sequences (ACT-TA bow, TATTTT and T-cluster) are found in both 5'-end and 3'-end flanking regions.

• Journal of Microbiology and Biotechnology
• /
• v.13 no.2
• /
• pp.287-291
• /
• 2003

Botulinum neurotoxin type A (BONT/A) is an extremely potent toxin, which is produced by Clostridium botulinum. The light chain of this protein (BONT/A LC), which is known as a zinc endopeptidase, cleaves SNAP-25 involved in the exocytosis process. In this work, the expression of recombinant BoNT/A LC in E. coli is described. The BONT/A LC gene of C. botulinum contains a high frequency of the arginine AGA and isoleucine ATA codons that are rarely used in genes of E. coli, hampering the translation of recombinant protein. The argD and ilex tRNA genes were cloned into pACYC184 vector, resulting in pAAD131X plasmid. The translational stress of the toxin gene related to codon bias was reversed by fupplernentation of the AGA arginyl tRNA of T4 phage and AUA isoleucyl tRNA of E. coli. This system may be applicable for the expression of a variety of AT-rich heterologous genes in E. coli.

• Biotechnology and Bioprocess Engineering:BBE
• /
• v.6 no.4
• /
• pp.301-305
• /
• 2001

The co-expression of the arg U gene in a double-vector expression system of recombi-nant Escherichia coli BL22(DE3)[pET-IEN2a+pAC-argU] significantly enhanced the production level of reconminant human interferon -$\alpha$2a(rhIFN-$\alpha$2a) in high cell density cultures, compared to a recombinant E. coli culture containing only the single expression vector, pET-IEN2a. The dry cell mass concentration increased to almost 100 g/L, and more than 4 g/L of rhIFN-$\alpha$2a was accumu-lated in the culture broth. Evidently, the synthesis of rhIFN-$\alpha$2a was strongly dependent on the pre-induction growtih rate and more efficient at a higher specific growth rate. The additional sup-ply of tRN $A^{Arg(AGG/AGA)}$ enhanced the expression level of the rhIFN-$\alpha$2a gene in the early stage of the post-induction phase, yet thereafter the specific production rate of rhIFN-$\alpha$2a rapidly de-creased due to severe segregational instability of plasmid vector pET-IEN2a. It would appear that the plasmid instability with only occurred to pET-IEN2a in the double vector system, was re-lated to the effect of translational stress due to the over expression of rhIFN-$\alpha$2a.

• Molecules and Cells
• /
• v.27 no.4
• /
• pp.429-441
• /
• 2009

We have determined the complete mitochondrial genome of the yellow-spotted long horned beetle, Psacothea hilaris (Coleoptera: Cerambycidae), an endangered insect species in Korea. The 15,856-bp long P. hilaris mitogenome harbors gene content typical of the animal mitogenome and a gene arrangement identical to the most common type found in insect mitogenomes. As with all other sequenced coleopteran species, the 5-bp long TAGTA motif was also detected in the intergenic space sequence located between $tRNA^{Ser}$(UCN) and ND1 of P. hilaris. The 1,190-bp long non-coding A+T-rich region harbors an unusual series of seven identical repeat sequences of 57-bp in length and several stretches of sequences with the potential to form stem-and-loop structures. Furthermore, it contains one $tRNA^{Arg}$-like sequence and one $tRNA^{Lys}$-like sequence. Phylogenetic analysis among available coleopteran mitogenomes using the concatenated amino acid sequences of PCGs appear to support the sister group relationship of the suborder Polyphaga to all remaining suborders, including Adephaga, Myxophaga, and Archostemata. Among the two available infraorders in Polyphaga, a monophyletic Cucujiformia was confirmed, with the placement of Cleroidea as the basal lineage for Cucujiformia. On the other hand, the infraorder Elateriformia was not identified as monophyletic, thereby indicating that Scirtoidea and Buprestoidea are the basal lineages for Cucujiformia and the remaining Elateriformia.

• BMB Reports
• /
• v.55 no.2
• /
• pp.81-86
• /
• 2022

Macrophages are a major cellular component of innate immunity and are mainly known to have phagocytic activity. In the tumor microenvironment (TME), they can be differentiated into tumor-associated macrophages (TAMs). As the most abundant immune cells in the TME, TAMs promote tumor progression by enhancing angiogenesis, suppressing T cells and increasing immunosuppressive cytokine production. N-myc downstream-regulated gene 2 (NDRG2) is a tumor suppressor gene, whose expression is down-regulated in various cancers. However, the effect of NDRG2 on the differentiation of macrophages into TAMs in breast cancer remains elusive. In this study, we investigated the effect of NDRG2 expression in breast cancer cells on the differentiation of macrophages into TAMs. Compared to tumor cell-conditioned medium (TCCM) from 4T1-mock cells, TCCM from NDRG2-over-expressing 4T1 mouse breast cancer cells did not significantly change the morphology of RAW 264.7 cells. However, TCCM from 4T1-NDRG2 cells reduced the mRNA levels of TAM-related genes, including MR1, IL-10, ARG1 and iNOS, in RAW 264.7 cells. In addition, TCCM from 4T1-NDRG2 cells reduced the expression of TAM-related surface markers, such as CD206, in peritoneal macrophages (PEM). The mRNA expression of TAM-related genes, including IL-10, YM1, FIZZ1, MR1, ARG1 and iNOS, was also downregulated by TCCM from 4T1-NDRG2 cells. Remarkably, TCCM from 4T1-NDRG2 cells reduced the expression of PD-L1 and Fra-1 as well as the production of GM-CSF, IL-10 and ROS, leading to the attenuation of T cell-inhibitory activity of PEM. These data showed that compared with TCCM from 4T1-mock cells, TCCM from 4T1-NDRG2 cells suppressed the TAM differentiation and activation. Collectively, these results suggest that NDRG2 expression in breast cancer may reduce the differentiation of macrophages into TAMs in the TME.

• Journal of Periodontal and Implant Science
• /
• v.41 no.6
• /
• pp.293-301
• /
• 2011

Purpose: We have previously reported that tetra-cell adhesion molecule (T-CAM) markedly enhanced the differentiation of osteoblast-like cells grown on anorganic bone mineral (ABM). T-CAM comprises recombinant peptides containing the Arg- Gly-Asp (RGD) sequence in the tenth type III domain, Pro-His-Ser-Arg-Asn (PHSRN) sequence in the ninth type III domain of fibronectin (FN), and the Glu-Pro-Asp-Ilu-Met (EPDIM) and Tyr-His (YH) sequence in the fourth fas-1 domain of ${\beta}$ig-h3. Therefore, the purpose of this study was to evaluate the cellular activity of osteoblast-like cells and the new bone formation on ABM coated with T-CAM, while comparing the results with those of synthetic cell binding peptide (PepGen P-15). Methods: To analyze the cell viability, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay was performed, andto analyze gene expression, northernblot was performed. Mineral nodule formations were evaluated using alizarin red stain. The new bone formations of each group were evaluated using histologic observation and histomorphometrc analysis. Results: Expression of alkaline phosphatase mRNA was similar in all groups on days 10 and 20. The highest expression of osteopontin mRNA was observed in the group cultured with ABM/P-15, followed by those with ABM/T-CAM and ABM on days 20 and 30. Little difference was seen in the level of expression of collagen type I mRNA on the ABM, ABM/T-CAM, and ABM/P-15 cultured on day 20. There were similar growth and proliferation patterns for the ABM/T-CAM and ABM/P-15. The halo of red stain consistent with $Ca^{2+}$ deposition was wider and denser around ABM/T-CAM and ABM/P-15 particles than around the ABM particles. The ABM/T-CAM group seemed to have bone forming bioactivity similar to that of ABM/P-15. A complete bony bridge was seen in two thirds of the defects in the ABM/T-CAM and ABM/P-15 groups. Conclusions: ABM/T-CAM, which seemed to have bone forming bioactivity similar to ABM/P-15, was considered to serve as effective tissue-engineered bone graft material.

• Clinical and Experimental Pediatrics
• /
• v.60 no.12
• /
• pp.408-412
• /
• 2017

Combined oxidative phosphorylation deficiency-17 (COXPD-17) is very rare and is caused by homozygous or compound heterozygous mutations in the ELAC2 gene on chromosome 17p12. The ELAC2 gene functions as a mitochondrial tRNA processing gene, and only 4 different pathogenic mutations have been reported in ELAC2-associated mitochondrial dysfunction involving oxidative phosphorylation. Affected patients show various clinical symptoms and prognosis, depending on the genotype. We report a novel mutation in the ELAC2 gene (c.95C>G [p.Pro32Arg], het), in an infant with COXPD-17 who presented with encephalopathy including central apnea and intractable epilepsy, and growth and developmental retardation. During hospitalization, consistently elevated serum lactic acid levels were noted, indicative of mitochondrial dysfunction. The patient suddenly died of shock of unknown cause at 5 months of age. This is the first case report of COXPD-17 in Korea and was diagnosed based on clinical characteristics and genetic analysis.

• Journal of The Korean Society of Inherited Metabolic disease
• /
• v.23 no.1
• /
• pp.25-30
• /
• 2023

Leigh syndrome is a rare progressive neurodegenerative mitochondrial disorder with clinical and genetic heterogeneity. Recently, balletic IARS2 variants have been identified in a number of patients presenting broad clinical phenotypes from Leigh and West syndrome to a rare syndrome CAGSSS characterized by cataracts, growth hormone deficiency, sensory neuropathy, sensorineural hearing loss, and skeletal dysplasia syndrome (OMIM#616007). We describe a child with Korean Leigh syndrome with urologic manifestations resulting from a compound heterozygote mutation in IARS2. A 5-year-old girl visited the emergency room with a complaint of abdominal pain accompanied by abdominal distension. Abdominal-pelvic CT showed a markedly distended urinary bladder without definite obstructive lesions. She was diagnosed with neurogenic bladder dysfunction based on a urodynamic study. She had global delayed development due to neurologic regression after 6 months of age and a history of bilateral cataract surgery at the age of 2 years. Her brain magnetic resonance imaging showed symmetrically increased signal intensities in the bilateral putamen and caudate nuclei with diffuse cerebral atrophy. No gene variants were identified through whole-mitochondrial genome analysis. Whole exome sequencing was performed for diagnosis, and compound heterozygous pathogenic variants were identified in IARS2: c.2446C>T (p. Arg816Ter) and c.2450G>A (p. Arg817His). To the best of our knowledge, this is the first case report of bladder dysfunction manifestation in a patient with IARS2-related Leigh syndrome. Thus, it broadens the clinical and genetic spectrum of IARS2-associated diseases.

• The Korean Journal of Physiology and Pharmacology
• /
• v.5 no.6
• /
• pp.495-501
• /
• 2001

We have cloned the mouse neurotensin/neuromedin N (NT/N) gene from the murine mast cell line Cl.MC/C57.1 for the first time. The murine NT/N cDNA clone consisted of 765 nucleotides and coded for 169 peptide residues with an N-terminal signal peptide, and the C-terminal region contained of one copy of neurotensin (NT) and one copy of neuromedin N (NN). Total of four Lys-Arg dibasic motifs were present; one each at the middle of the open reading frame, at the N-terminal of NN, at the C-terminal of NT, and between NN and NT. Amino acid sequence analysis of the mouse NT/N revealed 90% homology to that of the rat NT/N gene. NT/N is expressed in murine mast cell lines (Cl.MC/C57.1 and P815), but not in murine bone marrow-derived mast cells (BMMCs), murine macrophage cell line (RAW 264.7), nor in murine T cell line (EL-4). NT/N mRNA in C1.MC/C57.1 is highly inducible by IgE cross-linking, phorbol myristate acetate, neurotensin, and substance P. Following the treatment of demethylating agent, 5-azacytidine (5-azaC), the NT/N gene was induced in BMMCs in response to IgE cross-linking. 5-azaC-treated BMMCs did not express the NT/N gene without additional stimuli. These findings suggested that the regulation of NT/N gene expression was dependent on the effects of not only gene methylation but also enhancer and/or repressor proteins acting on the NT/N promoter.