Bacterial Species and Biochemical Characteristic Investigations of Nostoc flagelliforme Concentrates during its Storage

Abstract

Preservation of fresh algae plays an important role in algae seed subculture and aquaculture. The determination and examination of the changes of cell viability, composition, and bacterial species during storage would help to take suitable preservation methods to prolong the preservation time of fresh algae. Nostoc flagelliforme is a kind of edible cyanobacterium with important herbal and dietary values. This article investigated the changes of bacterial species and biochemical characteristics of fresh N. flagelliforme concentrate during natural storage. It was found that the viability of cells decreased along with the storage time. Fourteen bacteria strains in the algae concentrate were identified by PCR-DGGE and were grouped into four phyla, including Cyanobacteria, Firmicutes, Proteobacteria, and Bacteroidetes. Among them, Enterococcus viikkiensis may be a concern in the preservation. Eleven volatile organic compounds were identified from N. flagelliforme cells, in which geosmin could be treated as an indicator of the freshness of N. flagelliforme. The occurrence of indole compound may be an indicator of the degradation of cells.

Introduction

Propelled by the expansion of application fields and market demand of microalgae, many species of microalgae nowadays are produced by artificial liquid cultivation [1], in which seasonal production mode is commonly adopted by some microalgae manufacturers to save costs [15]. However, the seed supply has always been a bottleneck in microalgae scale-up cultivation owing to the lack of a large quantity of seeds in the spring season. In addition, most fresh microalgae products are used as initial feed in aquaculture for marine animals, particularly for larval, juvenile crustaceans, and fish [32]. Living microalgae are essential for raising fish at the critical early larval stages. Considering the importance of supplying living microalgae biomass in a short period [12], it is important to develop an appropriate preservation method to keep microalgae cells fresh and viable for their production.

Currently, the fresh microalgae are mainly preserved by subculture method [12], which is time-consuming and would be easily polluted by other microorganisms. Other preservation techniques have also been investigated, such as cryopreservation, freeze-drying, and low positive temperature concentrate preservation. Cryopreservation was studied in a range of microalgae, but no very-well established protocols were reported because some strains are not able to tolerate cryopreservation [6,26]. It was reported that no detectable recovery was observed in a number of algae species after being stored through freeze-dried cultures [5]. The preservation of microalgae concentrate at low positive temperature has been reported to be effective in ensuring cell viability [23]. It was reported that even after 5 months, viable Tetraselmis suecica cells could still be found in the microalgae concentrate preservation [23].

Nostoc flagelliforme is a kind of edible terrestrial cyanobacterium. In China, it is mainly distributed in the north and northwest areas. It has been used as food in China for more than 2,000 years with important herbal and dietary values [9]. As a kind of rare natural resource, many efforts for its artificial cultivation have been made in recent decades and liquid suspension cultivation was found to be a promising method for its large-scale production [10]. However, artificial N. flagelliforme cells can neither be preserved alive by using the cryopreservation method nor revived from the dry state. Moreover, N. flagelliforme is prone to mutate and easily polluted in the subculture procedure. Therefore, the preservation of fresh algae concentrate may be an optimal alternative for strain conservation and as seed for large-scale production of artificial N. flagelliforme cells. Thus, comprehension of the changes of cell viability, composition, and bacterial species during storage is vital to its application and may help to take suitable preservation methods to prolong the preservation time of fresh algae.

Microbial spoilage is by far the most common cause of food spoilage [11]. Spoilage is characterized by the changes in food products, including physical damage, chemical changes (oxidation, color changes), appearance, and off-flavors resulting from microbial growth and metabolism in the product [11]. Spoilage bacteria are commonly analyzed during food preservation [7]. It was also reported that volatile organic compounds (VOCs) from cyanobacteria also have a relationship with its life cycle [14]. Some VOCs were dominant in the growth phase of live cyanobacteria [20] and some other VOCs are often emitted during the spoilage of cyanobacteria, actinomyces, fungi, and blue-green algae [8]. For example, β-cyclocitral and β-ionone were reported to be associated with the damage or death of cyanobacteria [20]. Thus, the identification of the changes of dominant bacterial species and VOCs in algae concentrate during the storage can help find the most effective preservation methods to inhibit the spoilage and to extend the microalgae preservation time.

In this study, in order to intensify the comprehension of the changes of artificial N. flagelliforme cells in storage, so that suitable measures can be adopted to sustain their viability in storage and appropriate biomarkers will be found to indicate their freshness, several important parameters and characteristics were monitored and analyzed, including cell permeability, pH of the cell infiltration fluid, photosynthetic and respiratory rates, bacterial species, and VOCs.

 

Materials and Methods

Morphology and Viability Analyses of N. flagelliforme Cells

The strain of N. flagelliforme used for this research was obtained from the Tianjin Key Laboratory of Industrial Microbiology (Tianjin, China) and the cells were cultured in BG11 medium in an open 80 L air-lift light bioreactor at 25℃ for 20 days and then collected and condensed by gravity sedimentation in the form of algae concentrate (the water content is 59% (w/v)) [33]. The algae storage experiments were then conducted by storing 400 ml of the concentrate in a closed 500 ml conical flask at 23℃ constant temperature in the dark.

Photosynthetic and respiratory rates of N. flagelliforme cells in the algae concentrate were measured using an Oxy-lab O2 electrode (Hansatech, UK) at 25℃ [4]. The permeability of cells was determined by measuring the conductivity of the concentrate, where 1 ml of concentrated sample was put in a 50 ml tube containing 10 ml of commercial deionized water (Wahaha Co., China) and stored at 25℃ for 10 h in the dark. The initial conductivity (C1) of the mixture was measured with a conductivity meter (Mettler-Toledo, FE30, China) immediately. Then the tube was heated in a water bath (100℃) for 10 min and the conductivity (C2) of the mixture was measured for the second time after the mixture was cooled to 25℃. The permeability of N. flagelliforme cells can be calculated as follows:

The morphology change of N. flagelliforme cells during the storage time was observed with an optical microscope (Olympus, Japan) and a scanning electron microscope (Hitachi Limited, Japan).

Determination of Bacterial Species

Denaturing gradient gel electrophoresis (DGGE) was used to identify the bacterial species in the algae concentrate. It is a molecular fingerprinting technique based on the separation of polymerase chain reaction (PCR) amplicons of the same size but different sequences. PCR-DGGE has been successfully used in many fields of microbial ecology [2]. It was usually employed for the identification of the types of bacterial species and the assessment of microbial diversities [3]. The samples taken from N. flagelliforme concentrate at different storage times (1st, 10th, and 20th days) were frozen at −20℃, and then homogenized with liquid nitrogen and used for genomic DNA extraction with a CTAB (cetyltrimethylammonium bromide)-based method as previously reported [16]. The V3 region of bacterial 16S rDNA was amplified by PCR using primers 338F and 518R as previously reported [24]. A GC clamp was added to the forward primer 5’ end of 338F(CGCCCGGGGCGCGCCCCGGGGCGGGGCGGGGGCGCGGGGGGCCTACGGGAGGCAGCAG) in order to ensure that DNA fragment will remain partially double stranded [31]. The amplification was conducted by using a final volume of 50 μl of the mixtures listed in Table 1.

Table 1.Composition of the PCR system.

PCR was carried out with an initial denaturation step of 5 min at 94℃, followed by 30 cycles each of 1 min at 94℃, 45 sec at 55℃, and 1 min at 72℃, and a final extension of 10 min at 72℃. PCR products were purified using a DNA Gel Extraction Kit (OMEGA, Shanghai, China).

DGGE was performed by using a DCode Universal Mutation System (BioRad, Hercules, CA, USA), with the procedure as previously reported by Le Nyugen et al. [19]. The PCR amplicons (10 μl) prepared above were loaded into 8% (w/v) polyacrylamide gels (acrylamide/N,N-methylene bisacrylamide, 37.5/1; Promega, France) in 1× TAE buffer. A 30–60% gradient of urea and formamide was used to determine the structure of bacterial species [37]. Electrophoresis was performed at a constant voltage of 150 V and a temperature of 60℃ for 5 h. After electrophoresis, the gels were stained for 15 min with silver stain and photographed with a UV transilluminator. The DGGE images were analyzed using the Gel-Doc2000 software (Bio-Rad). The sequences obtained were compared with sequences in the BLAST/NCBI database (http://www.ncbi.nlm.nih.gov/BLAST) to determine the nearest matches.

Quantity One software (Bio-Rad) was used to align and process the individual lanes of gel images. As parameters of structural diversity of the microbial community, the Shannon (He) and Pielou eveness (Je) were quantified in terms of relative quantity of the bands and were calculated as follows [18]:

where N represent the populations of all species; Ni represent the number of species i; and S represent the number of species.

Determination of Volatile Organic Compounds

The geosmin standard (99.1%) was purchased from Wako Pure Chemical Industeries, Ltd. (Japan). Indole standard (>99%) was purchased from TCI (Shanghai) Development Co, Ltd. (China). β-Ionone standard (>95%) was manufactured by Tokyo Chemical Industry Co. Ltd. (Japan). β-Cyclocitral standard (>90%) was purchased from Alfa Aesar (a Johnson Matthey company). 2-Isobutyl-3-methoxypyrazine (IBMP) standard (99%) was purchased from Heowns Biochem Technologies (Tianjin, China).

Headspace solid-phase microextraction (HS-SPME) is one of the most popular techniques in pretreating and enriching odorants. It has been used routinely in combination with GC-MS and successfully applied to analyze a wide variety of compounds, especially for the extraction of volatile and semi-volatile organic compounds from environmental, biological, and food samples [27].

VOC analyses of algae concentrate were performed on the 1st, 3rd, 5th, 7th, 9th, 11th, 13th, 15th, 17th, and 20th days. The SPME technique was used for the enrichment of volatile compounds from the algae concentrates, and bipolar PDMS/DVB-coated silica fiber (Supelco; 65 μm partially crosslinked, 24 gauge) was employed to extract the volatile compounds from the headspace [27]. Before utilization, the fiber was pretreated at 250℃ for 30 min. Sampling was performed in a 10 ml vial containing 1 g of sodium chloride (Sinopharm Chemical Reagent Co., China), a stirring bar, and 3 ml of samples; the vial was sealed with a PTFE septum cap and placed in a water bath (75℃). 10 minutes later, the needle of the SPME penetrated the septum cap into the vial and the PDMS/DVB fiber was extended into the headspace. After 50 min, the fiber was retracted and immediately inserted into the GC injection port for composition analysis.

A Varian300 GC/MS (Varian Inc., CA, USA) instrument with a Varian VF-5 MS capillarity column (30 m × 0.25 mm × 0.5 μm) was used for the analyses of VOCs. Thermal desorption of the samples from the fiber was carried out in the split mode (split ratio 5:1) at a desorption temperature of 230℃ (injection port temperature) for 10 min. The carrier gas was helium and the flow rate was 0.8 ml/min. The column temperature started from 40℃ and was held for 3 min. Then the temperature increased with a gradient of 4℃/min to 150℃, followed by 8℃/min of gradient to 250℃. The electron ionization (EI) working conditions were as follows: ion-source temperature 220℃; MS transfer line temperature 280℃; solvent delay time 3 min; and ionizing voltage 70 eV. The mass spectrometer worked in full scan mode in the m/z range of 43-500. All determinations were performed in triplicates. The identification of VOCs was conducted by comparing the spectra of standards from the National Institute of Standards and Technology (NIST 05) Mass Spectral Library.

 

Results and Discussion

Changes of Viability of Cells

The viability of microalgae is vital to its application as seed or as initial feed in aquaculture because these applications require the microalgae to be alive. The viability change of N. flagelliforme cells can be characterized from the changes of permeability, photosynthesis, and respiration. The increase of permeability meant the breakage of cells. As shown in Fig. 1, the permeability of cells increased drastically for the first 7 days, after which it increased slowly. At the tenth day, it went up to 92.11%, which indicated that most of the cells were damaged. At the 20th day, 97.13% of the permeability showed that nearly all N. flagelliforme cells had been broken.

Fig. 1.The permeability of N. flagelliforme cells during storage.

Fig. 2 shows the photosynthetic and respiratory rate changes during the storage. It can be seen that the net photosynthetic rate, respiratory rate, and gross photosynthetic rate all decreased drastically within the first 3 days. After the fourth day, the gross photosynthetic rate and the net photosynthetic rate (gross photosynthetic rate minus respiratory rate) kept decreasing along with the storage time and dropped below zero from the fifth day, which suggested that N. flagelliforme cells lost their viability under the storage condition. The concurrence of the decrease of the respiratory rate and gross photosynthetic rate implied that the viability loss mainly resulted from the dissimilation of the algae cells, indicating that reducing the metabolic rate of the N. flagelliforme cells can prolong the duration of the cell’s activity. Low temperature control could be a promising solution in our case. As Harith et al. [13] reported, reduced temperature can slow both metabolic processes and autolysis while maintaining the cells viability. Thus, it is possible to prolong the storage of fresh N. flagelliforme concentrate by lowering the storage temperature.

Fig. 2.The photosynthetic rate and respiratory rate of N. flagelliforme cells during storage.

After the fourth day, the rapid increase of the respiration rate and the minus value of the net photosynthetic rate showed a massive outbreak of heterotrophic bacteria, which may help the rupture of N. flagelliforme cells. Subsequently, the gross photosynthetic rate further slowed down a nd c ame to 3. 69 μmol(O2)·mg(Chla)-1·h-1 at the eighth day. At the 9th day, the oxygen level was nearly above zero, but too low to be quantified by the machine, and consequently, only the data of eight days were recorded in Fig. 2. It could be postulated that at the 10th day, both the oxygen contained in the algae concentrate and the photosynthesis rate reached zero, which indicated that nearly all cells lost their viability after the 10th day. Thus, the 10th day is a critical time point for the characterization of the changes during the storage of N. flagelliforme concentrate. At the period from the 4th to 8th days, the sustained increase of heterotrophic bacterial metabolism may be the main reason for the viability decrease of N. flagelliforme cells. From the result of Figs. 1 and 2, it can be assumed that the dissimilation of N. flagelliforme cells and heterotrophic bacterial metabolism may take the main responsibility for the permeability increase and viability decrease of N. flagelliforme cells in the first eight days.

Morphology Change of N. flagelliforme Cells

Cell integrity is necessary for the survival of cells and it can be reflected from the morphology observation. The morphology of N. flagelliforme cells was observed by optical microscopy (Fig. 3) and scanning electron microscopy (SEM) (Fig. 4). The normal living N. flagelliforme cells at the first day aligned like strings of beads, just as shown in Figs. 3A and 4(1d), which showed the cells with normal viability. Thereafter, N. flagelliforme cells continued to shrink and lyse with the storage time. Figs. 3B, 3C, 4(5d), and 4(7d) indicated the ruins of the cell integrity, which were consistent with the changes in cell permeability in Fig. 1. At the 10th day, it can be seen from Fig. 4(10d) that most N. flagelliforme cells had shrunk and ruptured obviously, and Fig. 3B showed that many cells were lysed and the cell’s color became yellow although some cells and strings seemed still integral. Some holes are also observed from the image of Fig. 4(15d). At the 20th day, the cells lysed and the cell debris showed up, which were seen in Figs. 3C and 4(20d).

Fig. 3.Representative optical microscope images of N. flagelliforme cells at different storage times. A, B, and C represent the samples at 1, 10, and 20 days, respectively.

Fig. 4.Representative SEM images of N. flagelliforme cells at different storage times. Magnifications: ×10,000.

Analysis and Identification of Bacterial Species

Three storage time points of the 1st day, 10th day (when all N. flagelliforme cells lost their viability and the oxygen content in algae concentrate dropped to zero), and 20th day (when nearly all N. flagelliforme cells were broken and became the nutrients for anaerobic bacteria) were selected to investigate the changes of bacterial species along with the storage time. According to the principle of DGGE, the similar band at the same location in the DGGE fingerprint may be attributed to the same microorganism; thus, generally, the number of bands reflects the number of bacteria in samples, and the depth of a band reflects the amount of bacteria [38]. The 10, 14, and 16 bands were separated from the samples of 1st, 10th, and 20th days, respectively (Fig. 5). It showed that the structure of bacterial species in N. flagelliforme samples became more complicated with the storage time. The Shannon index (He) is a parameter of structural diversity of the microbial community and has been used to determine the diversity of a microbial community. As shown in Table 2, the order for He indexes of samples a, b, and c are He(a) > He(b)> He(c), which also confirmed that the structure of bacterial species in N. flagelliforme samples became more complicated with the storage time. There was no significant difference for Pielou eveness index (Je) among the three samples, which reflected similar uniformity of the bacterial species distribution among the three samples.

Fig. 5.PCR-DGGE band patterns of bacterial 16S rDNA of N. flagelliforme samples at three different storage times (a: 1st day; b: 10th day; c: 20th day).

Table 2.a, Shannon index. b, Pielou eveness.

Totally, 21 bands were separated from the three samples by migration through the DGGE gels (Fig. 5). Then each sequence of the 21 bands above was submitted to a BLAST search (http://www.ncbi.nlm.nih.gov/BLAST). The results of their closest relatives are shown in Fig. 6. Fourteen strains were identified and grouped into four phyla; Cyanobacteria, Firmicutes, Proteobacteria, and Bacteroidetes (Table 3). Strains 9, 10, and 12 were identified from the samples of 1st, 10th, and 20th days, respectively. Because of the diverse migrating behaviors of V3 fragments, several bands such as bands 1, 2, 3, and 5 represented the same bacteria, which were grouped into Firmicutes and affiliated with Pelosinus propionicus. Bands 8, 9, 11, and 13 were affiliated with Nostoc sp. but not N. flagelliforme, the possible reason for which was that there were no total 16S rDNA sequences of N. flagelliforme in the NCBI database. On the other hand, the classification of cyanobacteria was more difficult because the morphological features of filament, nutrition cell, heterocyst, and akinete of Nostoc species were similar with that of the relative genera, and the 16S rRNA gene sequences shared high similarity for them [21].

Fig. 6.Phylogenetic tree based on 16S rDNA sequences derived from DGGE patterns of the samples.

Table 3.Results of sequence alignment analysis.

Among all of these bacteria, some only appeared in specific times. The change of the species of the microorganisms with storage time might be attributed to differences in environmental conditions such as oxygen concentration and nutrition composition in N. flagelliforme samples. The oxygen concentration in the sample decreased with storage because the respiration rate kept increasing after the third day. The environment became more and more nutritious for heterotrophic bacteria with the release of the basic cytoplasm from the ruptured N. flagelliforme cells; thus, some anaerobic bacteria and chemo-organotrophic bacteria, which were closely related to oxygen levels in the concentrate and the rupture of N. flagelliforme cells, multiplied rapidly under some specific conditions and bacame dominant.

Hydrogenophaga defluvii (band 17), which was only detected in the sample of the 1st day, is gram-negative and able to grow chemolitho-autotrophically on H2 [17]. Thus, it may coexist with N. flagelliforme cells and disappeared with the loss of the viability of N. flagelliforme cells. Acinetobacter pittii (band 6) and Comamonas aquatica (band 18) were only detected in the sample of the 10th day. Acinetobacter pittii is is a gram-negative, oxidase-negative, catalase-positive, strictly aerobic heterotrophic nonmotile bacterium [25] and Comamonas is a genus of Proteobacteria [36]. Like all Proteobacteria, they are gram-negative, aerobic organisms and motile by using bipolar or polar tufts of 1–5 flagellae. Both Acinetobacter pittii and Comamonas aquatica are aerobic microorganisms. They gradually bred and multiplied in the aerobic storage of algae concentrate in the first 10 days, but gradually disappeared in the last 10 days of the anaerobic environment. Anaerospora hongkongensis (band 7), Ensifer adhaerens (band 20), and Clostridium amylolyticum (band 21) are strictly anaerobic [31,35] and they were detected only in the sample of the 20th day with the duration of last 10 days of anaerobic condition. Pelosinus propionicuis (bands 1, 2, 3, and 5) is a kind of chemoorganotrophic bacterium with fermentative metabolism [22]. Brevundimonas viscosa (band 16) cells can hydrolyze casein and tyrosine [34]. Thus, they may ferment the organic matter from N. flagelliforme cells, which contains 20–23% protein with 19 amino acids and about 56–57% carbohydrates [9], and accelerate the rupture of N. flagelliforme cells during the algae storage.

In addition, for the other bacteria, such as Pseudomonas oleovorans (band 15), the band was very dark, and it may easily multiply during the open cultivation of the N. flagelliforme cells in this experiment. There are few reports about them and it is unknown whether they have influence on the preservation of N. flagelliforme cells. Enterococcus viikkiensis (band 4) was detected in all the three samples of different storage time; it is ubiquitous in the environment and is very likely to be a spoilage organism if food is not refrigerated well [28]. Thus, it should be a concern to the preservation of N. flagelliforme cells, and in the subsequent investigation, proper measures should be taken to stop its infection or to inhibit its growth to prolong the preservation time of N. flagelliforme cells. Graham and Jerome [11] reported some preservatives for algae product. Thus, in the next step, we can try to add some preservatives to extend the preservation time of the N. flagelliforme cells.

Changes of Volatile Organic Compounds during the Storage Time

The VOCs were generated from the metabolism and spoilage of the algae concentrate. Their changes may reflect the viability of the algae and the degree of spoilage during the storage of N. flagelliforme cells. The VOCs from fresh N. flagelliforme cells were analyzed using HS-SPME coupled with GC-MS. Eleven compounds were identified through the comparison of mass spectra with standard compounds from the NIST 05 mass spectral library (Table 4). Compounds β-cyclocitral, β-ionone, and geosmin in N. flagelliforme concentrate at different storage times were quantitatively analyzed because of their close relationship with the life cycle of cyanobacteria [14,20].

Table 4.The GC-MS data of volatile organic compounds from N. flagelliforme.

As shown in Fig. 7, it was found that the relative amount of geosmin decreased with the storage time, which had a good correlation with the change of cell viability. Thus, geosmin can be taken as the index of freshness of artificial N. flagelliforme concentrate. Comparatively, the relative amount of β-cyclocitral and β-ionone was more stable during the whole storage period. Another volatile compound, indole, which comes from the degradation of amino acids [29], was detected at the 7th day and increased with the storage time. Therefore, indole can be taken as an indicator for the degradation of algae cells. β-Cyclocitral, β-ionone, geosmin, and indole were confirmed by matching the retention time and mass spectra with their corresponding standards. Their mass spectra are shown in Fig. 8.

Fig. 7.Changes of representative volatile compounds with storage time.

Fig. 8.Mass spectra of the target compounds.

Compared with the results of viability and morphology investigations discussed above, it can also be deduced that the 10th day is also a critical point for the VOCs’ change. The content of geosmin decreased drastically, inconsistent with the loss of cell viability of N. flagelliforme concentrate before this time. After then, it maintained at a low content range because there were nearly no algae cells alive. On the other hand, the low content of indole showed few algae cells deteriorated for the first 10 days, but it increased drastically owing to the significant spoilage of the N. flagelliforme cells for the last 10 days.

It could be summarized from the above research results that cell viability was drastically lost during the first 10 days of storage of artificial N. flagelliforme concentrate at a room temperature of 23℃, which was mainly attributed to the metabolism and cell autolysis of N. flagelliforme cells. Thus, some measures that can lower the algae metabolism and cell autolysis rates (e.g., a low storage temperature) may sustain the algae viability for a longer time. On the other hand, the breeding and propagation of a large number of heterotrophic microorganisms were an important reason for the spoilage of N. flagelliforme cells because the respiration rate increased drastically and a large number of heterotrophic microorganisms were found for the second 10 preservation days. Proper measures that can stop their infection or inhibit their growth (e.g., the addition of some preservatives) may inhibit the algae spoilage and prolong the preservation time of artificial N. flagelliforme concentrate.