Development of an In Planta Molecular Marker for the Detection of Chinese Cabbage (Brassica campestris ssp. pekinensis) Club Root Pathogen Plasmodiophora brassicae

  • Kim, Hee-Jong (Division of Applied Plant Sciences, College of Agriculture and Life Sciences, Kangwon National University) ;
  • Lee, Youn-Su (Division of Applied Plant Sciences, College of Agriculture and Life Sciences, Kangwon National University)
  • 발행 : 2001.03.01

초록

Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.

키워드

참고문헌

  1. Nucleic acid hybridization: a practical approach Preparation of nucleic acid probes Arrand J.E.;B.D. Hames(eds.);S.J. Higgins(eds.)
  2. Mycologia v.88 no.3 Molecular karyotypes for the obligate, intracellular plant pathogens, Plasmodiophora brassicae and Spongospora subterranea Bryan J.;T. Trese;P. Braselton
  3. Physiol. Mol. Plant Pathol. v.47 Development of specific PCR primers for the amplification of polymorphic DNA from the obligate root pathogen Plasmo-diophora brassicae Buhariwalla H.S.;Greaves R. Magrath;R. Mithen
  4. Mycologia v.85 A comparison of three techniques for inoculating Chinese cabbage with Plasmodiophora brassicae Castbury L.A.;D.A. Glawe
  5. Mycologia v.86 A technique for the extraction and purification of viable Plasmodiophora brassicae resting spore from host root tissue Castlebury J.A.;J.V. Maddox;D.A. Glawe
  6. Nucl. Acids Res. v.20 Rapid extraction of fungal DNA for PCR amplification Cenis J.L.
  7. Kor. J. Plant Pathol. v.14 Detection of Plasmodiophora brassicae by using polymerase chain reaction Chee H.Y.;W.G. Kim;W.D. Cho;H.J. Lee;Y.C. Choi
  8. Phytopathol. v.83 Comparison of monoclonal antibodies, DNA probes, and PCR for detection of grapevine yellows disease agent Chen K.H.;J.R. Guo;X.Y. Wu;N. Loi;L. Carraro;Y.H. Guo;Y.D. Chen;R. Osler;R.R. Pearson;T.A. Chen
  9. Kor. J. Mycol. v.25 RAPD analysis for the evaluation of genetic diversity among the Fusarium species from various sources Choi H.S.;K.S. Kim;M.J. Kim;Y.S. Lee
  10. J. Agr. Sci. v.8 Molecular analysis of genetic diversity among the Fusarium oxysporum and their forma specialis from various sources Choi H.S.;K.S. Kim;Y.S. Lee
  11. Basic plant pathology methods(2nd ed.) Dhingra O.D.;J.B. Sinclair
  12. Ainsworth and Bisby's Dictionary of the Fungi(8th ed.) Hawksworth D.L.;B.C. Sutton;D.N. Pegler
  13. Eur. J. Plant Pathol. v.104 PCR assay for specific detection of European stone fruit yellows Phytoplasmas and its use for epidemio-logical studies in France Jarausch W.;M. Lansac;C. Saillard;J.M. Broquaire;F. Dosba
  14. Mycol. Res. v.90 Use of PCR for detection of Mycosphaerella fijensis and M. musicola, the causal agents of Sigatoka leaf spots in banana and plantain Johanson A.;M.J. Jeger
  15. Plant Dis. Res. v.6 Distribution of Plasmodiophora brassicae causing clubroot disease of Chinese cabbage in soil Kim C.H.;W.D. Cho;H.M. Kim
  16. Physiol. Mol. Plant Pathol. v.39 Potential use of PCR-amplified ribosomal intergenic sequences in the detection and differentiation of Verticillium wilt pathogens Nazar R.N.;X. Hu;J. Schmidt;D. Culham;J. Robb
  17. Principles of vegetable and horticulture v.Cpt.6 Pyo H.G.;J.I. Choi;K.H. Lee
  18. Appl. Microbiol. Biotechnol. v.32 Highly sensitive and fast detection of Phoma tracheiphila by polymerase chain reaction Rollo F.;R. Salvi;P. Torchia
  19. Molecular cloning: A laboratory manual(2nd ed.) Sambrook J.;E.F. Fritsch;T. Maniatis
  20. Plant Pathol. v.34 Production and characterization of single-spore isolate of Plasmodiophora brassicae Scott E.S.
  21. Ann. Phytopathol. Soc. Jpn. v.54 A method for assessing the pathogenic activity of resting spores of Plasmodiophora brassicae by fluorescence microscopy Takahshi K.;T. Yamaguchi
  22. Physiol. Mol. Plant Pathol. v.48 Serological detection in soil of Plasmodiophora brassicae resting spores Wakeham A.J.;J.G. White
  23. Plant Pathol. v.43 Characterization of Polymyxa species by restriction analysis of PCR-amplified ribosomal DNA Ward E.;M.J. Adams