Korean Journal of Microbiology (미생물학회지)
- Volume 24 Issue 3
- /
- Pages.204-210
- /
- 1986
- /
- 0440-2413(pISSN)
- /
- 2383-9902(eISSN)
Aspergillus nidulans의 tRNA 유전자의 구조와 발현에 관한 연구 VI
Abstract
One clone(pANt32) carring tRNA/sup Arg/ gene was selected from Aspergillus total tRNA gene clones. The nucleotide sequences of this tRNA gene were determined by Maxam and Gilbert's chemical cleavage methods. The sequence of this tRNA gene is as follow; 5'GGCCGGCTGCCCAATTGGCAAGGCGTCTGACTACGAATCAGGAGAT TGCAGGTTCGAGCCCTGCGTGGGTCA3'. This sequence conicides with the characteristecs of other eukaryotic tRNA. Some consensus sequences (ACT-TA bow, TATTTT and T-cluster) are found in both 5'-end and 3'-end flanking regions.