• Korean Journal of Microbiology
• /
• v.24 no.3
• /
• pp.204-210
• /
• 1986

One clone(pANt32) carring tRNA/sup Arg/ gene was selected from Aspergillus total tRNA gene clones. The nucleotide sequences of this tRNA gene were determined by Maxam and Gilbert's chemical cleavage methods. The sequence of this tRNA gene is as follow; 5'GGCCGGCTGCCCAATTGGCAAGGCGTCTGACTACGAATCAGGAGAT TGCAGGTTCGAGCCCTGCGTGGGTCA3'. This sequence conicides with the characteristecs of other eukaryotic tRNA. Some consensus sequences (ACT-TA bow, TATTTT and T-cluster) are found in both 5'-end and 3'-end flanking regions.

• Journal of Life Science
• /
• v.10 no.4
• /
• pp.422-430
• /
• 2000

In order to search for the effects of Shine-Dalgarno (SD) sequence and nucleotide sequence of spacer region (SD-ATG) on bGH expression, oligonucleotides containing random SD sequences and a spacer region were chemically synthesized. The distance between SD region and initiation codon (ATG) was fixed to 9 nucleotides in length. The expression vectors have been constructed using pT7-1 vector containing a T7 promoter. Positive clones were screened with colony hybridization and named pT7A or pT7B plasmid series. The selected clones were confirmed by DNA sequencing and finally, 19 clones having various SD combinations were obtained. When bovine growth hormone was induced by IPTG in E. coli BL21(DE3), all cells harboring these plasmids produced a detectable level of bGH in western blot analysis. However, various SD sequences did not affect on bGH expression, indicating that the sequences of SD and the spacer region did not sufficiently destabilize mRNA secondary structure of bGH gene. Therefore, these results indicate that the disruption of mRNA secondary structure might be a major factor for regulating bGH expression in the translational initiation process.

• Microbiology and Biotechnology Letters
• /
• v.13 no.1
• /
• pp.19-25
• /
• 1985

The HIS5 gene of Saccharomyces cerevisiae host was encoded histidinol phosphate aminotransferase(E.C.: 2.6. 1.9). The HIS5 gene of Saccharomyces cerevisiae was cloned on plasmid pSH 530. This gene mighted be transcripted from a promoter of yeast gene both in E. coli and yeast hosts. We have determined the nucleotide sequence of the yeast HIS5 gene and its 5' and 3' flanking sequences. There are no large differences between the relative levels of HIS5 mRNA molecules with different 5' termini in represent and derepressed cell. In the DNA sequence upstream from the 5' termini of HIS5 mRNA we have found live closely related copies of a 9 base pair sequence. The sequence is also repeated in the 5' noncoding regions of HIS1, HIS3, HIS4, HIS5 and TRP5. Closely related sequence are not found flanking repeat sequence plays a role in the regulation of amino acid biosynthetic genes subject to the general amino acid control.

• Journal of fish pathology
• /
• v.6 no.2
• /
• pp.93-101
• /
• 1993

The RNAI mutation of Saccharomyces cerevisia is a recessive and temperature sensitive lethal mutation which interferes with the production of mRNA, rRNA, and tRNA. However, the precise role of RNAI gene have not been revealed until yet. We have cloned rna1-1 mutant gene from rna1-1 mutant yeast strain(R49 ; trpl, ura3-52, rna1-1). The 3.4kb BglII fragment of wild type RNAI clone(81-2-6) contains whole RNAI gene. The genomic southern blotting with BglII digested R49 genomic DNA as a probe shows the unique and identical band with wild type 3.4kb BglII fragment. Therefore, We prepared partial BglII genomic library(3~4kb BglII fragments) into BamH I site of pUC19. The rna 1-1 mutant clone was screened with Digoxigenin(DIG)-lableled probe by high density colony hybridization. The 5'-flanking region of rna1-1 gene was sequenced by dideoxy chain termination method. The 5'-flanking sequence of RNAI gene contains three TATA-like sequence ; TAATA, TATA and TTTTAA at position of -67, -45, and -36 from first ATG codon respectively. The 5'-flanking region of wild type RNA I gene from ATG codon to -103nt was deleted with Bal31 exonuclease digestion, generating $pUC{\Delta}$/RNA I. After constructing $pYEP{\Delta}RNA$ I (consists of -103nt deleting RNA I gene, URA3 gene, $2{\mu}m$ rep. origin), pYEPrna1-1(consists of Xba I fragment of pUCrna1-1. URA3 gene, $2{\mu}m$ rep. origin), and pYEPRNAI. each plasmid was transformed into host strain(trpl, ura3-52, rna1-1) by electroporation, respectively. Yeast transformant carrying $pYEP{\Delta}RNA$ I did not complement the thermal sensitivity of rna1-1 gene. It means that TATA-like sequences in 5'-flanking region is not TATA sequence for transcribing RNAI gene and there may be other essential sequence in upstream region for the transcription of RNAI gene.

• Journal of Microbiology
• /
• v.44 no.1
• /
• pp.64-71
• /
• 2006

To investigate the effects of the nucleotide sequences in Shine-Dalgarno (SD) and the spacer region (SD-ATG) on bovine growth hormone (bGH) gene expression, the expression vectors under the control of the T7 promoter (pT7-7 vector) were constructed using bGH derivatives (bGH1 & bGH14) which have different 5'-coding regions and were induced in E. coli BL21 (DE3). Oligonucleotides containing random SD sequences and a spacer region were chemically synthesized and the distance between the SD region and the initiation codon were fixed to nine bases in length. The oligonucleotides were annealed and fused to the bGH1 and bGH14 cDNA, respectively. When the bGH gene was induced with IPTG in E. coli BL21(DE3), some clones containing only bGH14 cDNA produced considerable levels of bGH in the range of $6.9\%\;to\;8.5\%$ of total cell proteins by SDS-PAGE and Western blot. Otherwise, the bGH was not detected in any clones with bGH1 cDNA. Accordingly, the nucleotide sequences of SD and the spacer region affect on bGH expression indicates that the sequences sufficiently destabilize the mRNA secondary structure of the bGH14 gene. When the free energy was calculated from the transcription initiation site to the +51 nucleotide of bGH cDNA using a program of nucleic acid folding and hybridization prediction, the constructs with values below -26.3 kcal/mole (toward minus direction) were not expressed. The constructs with the original sequence of bGH cDNA also did not show any expression, regardless of the free energy values. Thus, the disruption of the mRNA secondary structure may be a major factor regulating bGH expression in the translation initiation process. Accordingly, the first stem-loop among two secondary structures present in the 5'-end region of the bGH gene should be disrupted for the effective expression of bGH.

• BMB Reports
• /
• v.31 no.6
• /
• pp.578-584
• /
• 1998

In a previous paper (Kim et al., 1996a), the immediate 5' -flanking region and coding region of the human UDP-N -acetylglucosamine:-D-mannoside-1,4-Nacetylglucosaminyltransferase III (N-acetylglucosaminyitransferase- III; GnT-III) gene was reported, isolated and analyzed. Herein, we report on amplification of a new 5' -noncoding region of the GnT-III mRNA by single-strand ligation to single-stranded cDNA-PCR (5' -RACE PCR) using poly(A)+ RNA isolated from human fetal liver cells. A cDNA clone was obtained with 5' sequences (96 bp) that diverged seven nucleotides upstream from the ATG (+1) start codon. A concensus splice junction sequence, TCTCCCGCAG, was found immediately 5' to the position where the sequences of the cDNA diverged. The result suggested the presence of an intron in the 5' -noncoding region and that the cDNA was an incompletely reversetranscribed cDNA product derived from an mRNA containing a new noncoding exon. When mRNA expression of GnT-III in various human tissues and cancer cell lines was examined, Northern blot analysis indicated high expression levels of GnT-III in human fetal kidney and brain tissues, as well as for a number of leukemia and lymphoma cancer cell lines. Promoter activities of the 5' -flanking regions of exon 1 and the new noncoding region were measured in a human hepatoma cell line, HepG2, by luciferase assays. The 5'-flanking region of exon 1 was the most active, whilst that of exon 2 was inactive.

• Korean Journal of Ichthyology
• /
• v.23 no.1
• /
• pp.10-20
• /
• 2011

Genetic determinant for metallothionein (MT), a cysteine-rich protein playing essential roles in metal detoxification and homeostasis, was characterized in the Korean bitterling (Acheilognathus signifer, Cyprinidae), an endemic fish species. The full-length A. signifer MT (AsMT) cDNA (551 bp) is composed of a single open-reading frame (ORF) to encode a polypeptide of 60 amino acids containing 20 cysteine residues whose positions are conserved in most cypriniform MTs. At the genomic level, the AsMT (2,593 bp spanning the 5'-flanking region to the 3'-untranslated region) represented a conserved tripartite (three exons interrupted by two introns) structure with AT-rich introns. The upstream regulatory region (-1,914 bp from the ATG initiation codon) of AsMT displayed various sites and motifs for transcription factors involved in the metal-mediated regulation and stress/immune responses. The AsMT transcript was ubiquitously detected in various organs with variable expression levels, where the ovary and intestine showed the highest expression, while the heart and skeletal muscle represented the lowest level. During an exposure to copper (immersion in $0.5\;{\mu}M$ Cu for 48 h), the levels of AsMT transcripts were significantly elevated in the liver (more than 3.5-fold), moderately in the gill, kidney, and spleen (ranging from 1.5- to 2.5-fold), and barely in the brain and intestine. Results of this study could form a useful basis to explore the metal-related stress physiology of this endangered fish species.

• Journal of Sericultural and Entomological Science
• /
• v.49 no.2
• /
• pp.37-42
• /
• 2007

Lactoferrin, an ion-binding 80-kDa glycoprotein, has been suggested to have many biologic activities, such as facilitating ion absorption and having antimicrobial and anti-inflammatory effects. Several of these activities are likely to only be facilitated by human lactoferrin because they depend on the binding of human lactoferrin to specific receptor. To produce recombinant human lactoferrin to animal foods using transgenic silkworm, Bombyx mori L, we have cloned and sequenced the cDNA encoding for a human lactoferrin (HLf) from the mRNA in mammary tumor line (GI-101). As a result, the 2.5-kb fragment of HLf gene was cloned with pGEM-T vector and then this fragment was sequenced. In the nucleotide sequence analysis, single open reading frame of the 2,136-bp encoding for a polypeptide of 712 amino acid residues was detected. On the other hand, we constructed a recombinant plasmid(pPT-HLf), containing human lactoferrin gene for germ line transformation of the silkworm using a piggyBac transposon-derived vector. A nonautonomous helper plasmid encodes the piggyBac transposase. Approximately 6.7% of individuals in the G0 silkworms expressed green fluorescent protein (GFP). PCR analyses of GFP-positive silkworms (G0 and G1) revealed that independent insertions occurred frequently. Furthermore, Western blot analysis showed that the recombinant HLf expressed in hemolymph has the same molecular weight (80 kDa) as a native protein. On the basis of these experiments, expression of HLf in next generation of transgenic silkworm is now in process.