• 제목/요약/키워드: total RNA

Search Result 1,749, Processing Time 0.024 seconds

Effects of Nitrogen Nutrient on the Yield, Protein, Amino acid, Chlorophyll, Carotene, RNA, and DNA Contents in Rye-Grasses (Rye-grass류의 물질생산, 단백질, aminotks, 엽록소, Carotene, RNA 및 DNA의 함량에 미치는 질소의 영향)

  • 장남기
    • Journal of Plant Biology
    • /
    • v.16 no.1_2
    • /
    • pp.30-38
    • /
    • 1973
  • To study the response to plant growth by the environmental factors, the effects of application of nitrogen on changes in the yield, crude protein, amino acids, chlorophyll, carotene, total phosphorus, acid-soluble phosphorus, phospholipids, RNA, and DNA were investigated with westerworlds 9Lolium sublatum) and perennial rye-grasses (Lolium perenne). The amounts of dry weight, crude protein, amino acids, chlorophyll, carotene, total phosphorus, acid-soluble phosphorus, phospholipids, RNA and DNA of both rye-grasses increased with adequately increasing nitrogen, and reached a maximum with an adequate application of nitrogen. The relationships between yields and crude protein contents, crude protein and RNA contents, and yields and RNA contents of westerworlds and perennial rye-grasses were found to be positively correlated, respectively. Therefore, in general, the response to plant growth by the environmental factors such as nitrogen nutrient may be summarized as follows: Environmental factors\longrightarrowDNA\longrightarrowRNA\longrightarrowProtein\longrightarrowPlant growth

  • PDF

A Simple Procedure for RNA Isolation from Plants and Preservation of Plant Material for RNA Analysis (간편한 고등식물 RNA 분이 방법)

  • Hong, Choo-Bong;Jeon, Jae-Heung
    • Journal of Plant Biology
    • /
    • v.30 no.3
    • /
    • pp.201-203
    • /
    • 1987
  • Total RNA was isolated from two months old wheat, rice, tobacco and sweet potato. The procedure used was simple and provided pure RNA preparation. Lysis of plant tissue in a buffer with guanidine thiocyanate and CsCl density gradient centrifugation separated RNA from the rest of the cellular components. Subsequent cholroform/1-butanol extraction and ethanol precipitation were necessary to ensure contaminant-free RNA preparation. Storage of the lysed plant tissue in the buffer with guanidine thiocyanate preserved the sample for two months without noticeable RNA degradation.

  • PDF

Comparison of Protein DNA, and RNA Contents in Corpus Luteum without and with Central Cavity in Dairy Cow (젖소의 난소 황체에 있어서 중심강의 유무에 따른 Protein, DNA, RNA 함량의 비교)

  • ;Y. S. Kim;C. N. Lee
    • Korean Journal of Animal Reproduction
    • /
    • v.26 no.1
    • /
    • pp.73-78
    • /
    • 2002
  • This study was conducted to investigate total protein, DNA, and RNA content in corpus luteum(CL) without and with central cavity in dairy cow. Stage of the estrous cycle of corpus luteum from slaughterhouse(CL3, days 11 to 17) was classified by method of Ireland et. al.(1980). Corpus luteum was classified into corpus luteum without(less than 2mm in diameter) and with central cavity(more than 2mm in diameter) by method of Kastelic et. al.(1990). 1 In total protein content, CL with central cavity did not differ from CL without central cavity. 2. In DNA content, CL with central cavity was significantly lower than CL without central cavity(p<0.05). 3. In protein: DNA ratios, CL with central cavity was significantly lower than CL without central cavity(p<0.05). 4. But in RNA content, protein:RNA and RNA:DNA ratios, CL with central cavity did not differ from CL without central cavity.

Aspergillus nidulans의 tRNA 유전자의 구조와 발현에 관한 연구 VI

  • 이병재;강현삼
    • Korean Journal of Microbiology
    • /
    • v.24 no.3
    • /
    • pp.204-210
    • /
    • 1986
  • One clone(pANt32) carring tRNA/sup Arg/ gene was selected from Aspergillus total tRNA gene clones. The nucleotide sequences of this tRNA gene were determined by Maxam and Gilbert's chemical cleavage methods. The sequence of this tRNA gene is as follow; 5'GGCCGGCTGCCCAATTGGCAAGGCGTCTGACTACGAATCAGGAGAT TGCAGGTTCGAGCCCTGCGTGGGTCA3'. This sequence conicides with the characteristecs of other eukaryotic tRNA. Some consensus sequences (ACT-TA bow, TATTTT and T-cluster) are found in both 5'-end and 3'-end flanking regions.

  • PDF

Biochemical Studies on the Chemical Components of Borean Ginseng (ll) Effects of Ginseng Components on the Activity of RNA Polymerase (한국 인삼 성분들에 관한 생화학적 연구(II) 인삼 성분들이 RNA 중합효소의 활동성에 미치는 영향)

  • 장세희;박인원
    • Journal of Ginseng Research
    • /
    • v.1 no.1
    • /
    • pp.25-28
    • /
    • 1976
  • Ginseng extracts were fractionated into several fractions with various organic solvents, and the effects of these fractions on the activity of RNA polymerase were examined. Fractions which showed positive effect on the activity of RNA polymerase were obtained both from white ginseng and red ginseng. For white ginseng the components which hare shown a positive effect on RNA polymerase roue found in total methanol extracts, the residual aqueous solution from ethyl acetate extraction and the methanol insoluble fraction of the above solution, whereas for red ginseng the positive components roue found in total methanol extracts and in ethyl ether extracts. These finding suggest that the ginseng components which have Positive effect on RNA polymerase be composed of Polar and nonpolar moieties, which may be cleaved into the ports during the processing the of red ginseng.

  • PDF

Change of Yeast Growth and Its RNA Content in Fed-batch Fermentation (유가식 배양에서 효모 생육과 RNA 함량의 변화)

  • Kim, Sung-Yong;Nam, Hee-Sop;Lee, Hyung-Jae
    • Korean Journal of Food Science and Technology
    • /
    • v.28 no.1
    • /
    • pp.122-126
    • /
    • 1996
  • Growth patterns of Saccharomyces cerevisiae NS 2031 and its total RNA contents were observed by a fed-batch fermentation with different media-feeding methods. With an exponential feeding pattern, both final cell concentrations and intracellular RNA contents decreased with increasing feeding rates. Intracellular RNA contents also decreased with the growth time. At the same feeding rate of the exponential pattern, final cell concentrations decreased with the increase of total sugar concentration whereas intracellular RNA contents increased. The highest cellular yield was 0.47 at the total sugar concentration of 10%. With increasing feeding rates of the parabolic feeding pattern, final cell concentrations decreased whereas intracellular RNA contents increased, showing a different tendency from the exponential feeding pattern. In comparison of two feeding methods, the exponential feeding pattern was better than the parabolic feeding pattern in terms of cell growth, cellular yields and intracellular RNA contents of Saccharomyces cerevisiae NS 2031. Also, the intracellular RNA contents of the exponential feeding pattern was found to be about 2% higher than that of the parabolic feeding pattern at the same instantaneous growth rate $({\mu}_{inst})$.

  • PDF

Clonorchis sinensis tropomyosin: Cloning and sequence of partial cDNA amplified by PCR (간흡충 tropomyosin: PCR로 일부분 증폭된 cDNA의 cloning 및 염기서열)

  • 홍성종
    • Parasites, Hosts and Diseases
    • /
    • v.31 no.3
    • /
    • pp.285-292
    • /
    • 1993
  • C. sinensis total RMh was containing large amount of 185 rRNA but little 285 rRNA. The size of the double-stranded cDNA synthesized from poly $(A)^{+}$ mRNA was 0.4-4.2 kb long with tapering unto 9.5 kb. Degenerated oligonucleotides (as 2 sense and 3 antisense Primers) were designed on the conserved regions of the known tropomyosin amino acid sequences. From one out of the PCR amplifications using total CDNA and matrix of primers, a specific gene product, 580 bp in size, was produced. Upon Southern hybridization of the PCR products with Schistosomn mnnsoni tropomyosin (SMTM) CDNA, only one signal appeared at the band of 580 bp product. This 580 bp product was considered to encode C. sinensis tropomyosin (CSTM) and cloned in pGEM-3Zf(-) for DNA sequencing. CSTM cDNA was 575 bp containing one open reading frame of 191 predicted amino acids, which revealed 86.3% homology with SMTM and 51.1% with rrichostronsylur coeubnlormis tropomyosin. CSTM cDNA obtained will serve as a probe in the studies of molecular cloning of CSTM.

  • PDF

Characterization of growth hormone-like sequence of loach, Misgurnus mizolepis (미꾸라지 성장 호르몬 염기 서열의 특성에 대하여)

  • Kim, Jin-Kyung;Song, Young-Hwan
    • Journal of fish pathology
    • /
    • v.7 no.2
    • /
    • pp.95-103
    • /
    • 1994
  • We have prepared cDNA libray of loach. M. mizolepis in order to isolate cDNA clone of growth hormone gene. Total RNA was isolated from pituitary of loach, and then mRNA was further purified from total RNA by oligo (dT)-coupled magnetic beads. The purified mRNA was used as substrates to prepare cDNA. The resulting cDNA was ligated into the EcoRV/Smal site of pBlueKS+. The ligation mixture have transformed E. coli JM109 strain with electroporator to obtain high yield of transformation efficiency. All the transformants was screened with DIG-labeled Tilapia growth hormone gene by high density colony hybridization. After isolating 10 putative colonies showing the positive signals, secondary colony hybridization and southern hybridization could confirm it as true clones. The nucleotide sequence of one candidate, pCGHI, was compared with 312 bp DNA fragment used as DNA probe and show 52% relative homology to Tilapia growth hormone gene.

  • PDF

Interleukin-8 gene expression in the human colon epithelial cell line, HT-29, exposed to Entamoeba histolytica (이질아메바에 의한 인체 대장상피세포주 HT-29에서의 interleukin-8 유전자의 발현)

  • 김정목;정현채
    • Parasites, Hosts and Diseases
    • /
    • v.33 no.4
    • /
    • pp.357-364
    • /
    • 1995
  • The protozoan parasite, Entcmoeba histoIWticc, is one of major causative agents of intestinal disease all over the world. In acute experimental infection, the early host response to 5. histoIHtica is characterized by an infiltration of neutrophils. However, the chemotactic signal for this response is not well known. Based on the (jading that human epithelial cells produce the potent neutrophil chemoattractant and activator, interleukin-8 (IL-8), IL-8 gene expression was examined thoroughly in human colon epithelial cells exposed to 5. histolvtica trophozoites. Cellular RNAs were extracted from HT-29 or Caco-2 human colon epithelial cells exposed to 5. histoLvtica trophozoites for 30 minutes, 1 and 3 hours. IL-8 mRNA transcripts were measured by reverse transcriptional polprnerase chain reaction (RT-PCR) using synthetic standard RNA. The number of IL-8 mRNA molecules increased from 30 minutes to 3 hours of exposure period, reaching 3.1 H 107 molecules/ug of total RNA. Expression pattern of IL-8 mRNA transcripts was parallel to the amounts of IL-8 protein measured by enzyme-linked immunosorbent assay (ELISA) . Lysates of 5. histoIVtica also induced expression of mRNA for IL-8 in colon epithelial cells. These results sugf:esc that acute inflammatory reaction by 5. histoIVticc may be initially triggered by proinflammatory cytokines such as IL-8 secreted from epithelial cells of the colon.

  • PDF

Studies on the Chromatin Isolated from the Organs of Animals Received Whole-body X-ray Irradiation

  • Han, Su Nam
    • Korean Journal of Veterinary Research
    • /
    • v.7 no.2
    • /
    • pp.13-18
    • /
    • 1967
  • 1. Within experimental chromatin, the total protein: DNA ratio did not vary in the same organs of control and irradiated rats. However, the amount of RNA and total protein associated with the DNA varied considerably among the different types of chromatin. In particular, the content of chromatin was the control tissue. RNA and total protein ratio of chromatins from brtain, liver, testis and spleen declined with experimental I organs. 2. There was the same quantitative relationship between the amount of RNA and the amount of histone-protein associated with DNA in chromatin. 3. RNA: DNA ratio of chromatin showed 1.5-2 times increas in the irradiated organs except brain. However, RNA: DNA ratio was decreased in chromatin by irradiation. 4. Histone-protein:residual protein ratio was greatly varied among the organs. However, the effect was not found by irradiation. 5. Priming activity of chromatin showed a higher value in testis and the activity was greater in organs with higher metabolic activity: 6. Inhibition of Actinomycin D is observable in chromatin from testis, liver, spleen and brain declined without relationship between irradiated and non-irradiated conditions. Ammonium sulfate showed increased priming activity by the electrostatic dissociation of DNA and histone in chromatin on the stimulation depending on property of chromatins. 7. It is suggested that the results support a proposal that testis and spleen of highly sensitive to irradiation should an increase in the priming activity whereas brain and liver of lower sensitivity decreased in the activity.

  • PDF