• Journal of Crop Science and Biotechnology
• /
• 제10권1호
• /
• pp.50-56
• /
• 2007

Barley S-adenosylmethionine synthetase1 gene, which was differentially expressed in seed development of extra early barley, was regulated by the phytohormones and abiotic stresses. In order to identify the regulation regions which were involved in transcriptional control of the phytohormones and abiotic stresses, we isolated 1459 bp fragment of HvSAMS1 gene promoter using genome walking strategy and deletion series were constructed. Deleted upstream fragments(-1459, -1223, -999, -766, -545, -301 bp) were fused to the GUS reporter gene and evaluated via Agrobacterium-mediated transient expression assay. Increased GUS activity of HvSMAS1 promoter -301/GUS construct under each of NaCl, $GA_3$, ABA and ethylene application was found. However, GUS activity was negligible in the leaves transformed with the HvSMAS1 promoter(-1459, -1223, -999, -766 and -545)/GUS constructs. No significant induction of GUS activity was observed for the ethionine and spermidine treatments. In order to locate promoter sequence of the HvSAMS1 gene that was critical for the activation of gene expression, deletion and addition promoter derivatives(+, includes 43 bp of 5' ORF) of the HvSAMS1 gene fused to the GUS reporter gene were applied. The tobacco leaves which harbored the additional HvSAMS1 promoter(-1459+, -1459 to -546, -545+ and -301+)/GUS construct did not significantly induce GUS activity as compared to the HvSAMS1 promoter(-1459, -545 and -301)/GUS constructs under each of NaCl, ABA and $GA_3$ treatment. However, the GUS activity was high in the tobacco leaves which harboring the -211 to -141 regions of the HvSAMS1 promoter. This result suggested that HvSAMS1 gene expression might be regulated by this region(from -211 to -141).

• International Journal of Industrial Entomology and Biomaterials
• /
• 제15권2호
• /
• pp.131-135
• /
• 2007

Open reading frame 4 of Bombyx mori nucleopolyhedrovirus (BmNPV), designated as Bm4, is a gene whose function is completely unknown. With the recently developed BmNPV bacmid and a modified pFastBac1 whose polyhedrin promoter was replaced with ie1 promoter, a recombinant bacmid expressing Bm4-EGFP fusion protein under the control of ie1 promoter in BmN cells was successfully constructed. The result not only showed that the polyhedrin promoter can be replaced efficiently with other promoters to direct the expression of foreign gene in BmN cells by using Bac-to-Bac/BmNPV baculovirus expression system but also laid the foundation for rescue experiment of Bm4 deletion mutant due to the ability of ie1 promoter to direct gene expression throughout the infection cycle.

• Journal of Plant Biotechnology
• /
• 제40권1호
• /
• pp.27-36
• /
• 2013

We isolated and functionally characterized a Dendrobium Actin1 (DmACT1) promoter that drives strong gene expression in the orchid genus Dendrobium. A genomic fragment containing the region 3227 bp upstream of the coding region of DmACT1 was obtained by inverse PCR. Detailed comparison of the full-length cDNA and genomic sequences revealed that DmACT1 has a 1374 bp first intron in the 5' UTR. However, the 5' flanking sequences upstream of the coding region showed no obvious sequence similarities compared to those of known promoters, including plant actin promoters. Serial deletion constructs of the 5' flanking region from the translation initiation codon were fused to the coding sequence of a GUS/luciferase fusion reporter to identify the regulatory elements necessary for promoter activity. Transient assays in the flowers of Dendrobium revealed that the 5' UTR-intron greatly enhanced promoter activity. Moreover, the DmACT1 promoter with its 5' UTR-intron yielded approximately 10-fold higher reporter activity than the rice Act1 promoter-intron. Our data suggest that the DmACT1 promoter with its 5' UTR-intron is a useful tool for strong expression of transgenes in Dendrobium orchids.

• Mycobiology
• /
• 제46권4호
• /
• pp.429-439
• /
• 2018

To develop a convenient promoter analysis system for fungi, a null-pigment mutant (NPG) of Aspergillus nidulans was used with the 4'-phosphopantetheinyl transferase (PPTase) gene, npgA, which restores the normal pigmentation in A. nidulans, as a new reporter gene. The functional organization of serially deleted promoter regions of the A. nidulans trpC gene and the Cryphonectria parasitica crp gene in filamentous fungi was representatively investigated to establish a novel fungal promoter assay system that depends on color complementation of the NPG mutant with the PPTase npgA gene. Several promoter regions of the trpC and crp genes were fused to the npgA gene containing the 1,034-bp open reading frame and the 966-bp 3' downstream region from the TAA, and the constructed fusions were introduced into the NPG mutant in A. nidulans to evaluate color recovery due to the transcriptional activity of the sequence elements. Serial deletion of the trpC and crp promoter regions in this PPTase reporter assay system reaffirmed results in previous reports by using the fungal transformation step without a laborious verification process. This approach suggests a more rapid and convenient system than conventional analyses for fungal gene expression studies.

• Journal of Plant Biology
• /
• 제35권2호
• /
• pp.155-163
• /
• 1992

식물세포에 tumor를 유발하는 Agrobacterium tumefaciens pTiA6 plasmid에서 virE 유전자의 발현조절기작을 분자적수준에서 규명하기 위하여 virE promoter의 5＇-말단을 제거하여 얻은 truncated virE 재조합플라스미드를 이용하여 virE promoter의 조절부위에 대하여 연구하였다. virE promoter의 기능이 존재하는 truncated virE 재조합플라스미드인 pJS201은 전기영동에 의하여 virE promoter의 5＇-말단으로부터 약 130개의 염기가 제거된 것으로 측정되었다. 한편 virE promoter의 기능을 상실한 pJS301에서 dideoxy chain termination방법으로 truncated virE promoter 염기서열을 결정한 결과 263개의 염기가 제거된 것으로 확인되었다. 따라서 virE promoter의 조절부위는 virE promoter의 5＇-말단으로부터 약 130번째의 염기에서 263번째의 염기사이에 존재하는 것으로 사료되며, 이 사이에 23개의 염기로 이루어진 역반복서열(AACTTTGCGCTATAGGCAAAGTT)이 존재하고 있는데, 이 부위가 virE operon의 발현에 있어서 RNA polymerase의 최초 인식부위(recognition site)일 것으로 사료된다.

• Reproductive and Developmental Biology
• /
• 제36권3호
• /
• pp.207-212
• /
• 2012

The shortage of human organs for transplantation has induced the research on the possibility of using animal as porcine. However, pig to human transplantation as known as xeno-transplantation has major problem as immunorejection. Recently, the solutions of pig to human xenotransplantation are commonly mentioned as having a genetically modification which include alpha 1, 3 galatosyl transferase knockout (GTKO) and immune-suppressing gene transgenic model. Unfortunately, the expression level of transgenic gene is very low activity. Therefore, development of gene overexpression system is the most urgent issue. Also, the tissue specific overexpression system is very important. Because most blood vessels are endothelial cells, establishment of the endothelial-specific promoter is attractive candidates for the introduction of suppressing immunorejection. In this study, we focus the ICAM2 promoter which has endothelial-specific regulatory region. To detect the regulatory region of ICAM2 promoter, we cloned 3.7 kb size mini-pig ICAM2 promoter. We conduct serial deletion of 5' flanking region of mini-pig ICAM2 promoter then selected promoter size as 1 kb, 1.5 kb, 2 kb, 2.5 kb, and 3 kb. To analyze promoter activity, luciferase assay system was conducted among these vectors and compare endothelial activity with epithelial cells. The reporter gene assay revealed that ICAM2 promoter has critical activity in endothelial cells (CPAE) and 1 kb size of ICAM2 promoter activity was significantly increased. Taken together, our studies suggest that mini-pig ICMA2 promoter is endothelial cell specific overexpression promoter and among above all size of promoters, 1 kb size promoter is optimal candidate to overcome the vascular immunorejection in pig to human xenotransplantation.

• Animal cells and systems
• /
• 제4권2호
• /
• pp.181-186
• /
• 2000

The expression of $p21^{WAF1/ClP1/SDl1}$, one of the cyclin-dependent kinase inhibitors, is regulated by a variety of transcription factors including p53 and STAT. Heat shock induces the expression of p21 in a temperature- and time-dependent manner. Although the p21 induction by heat shock has been reported to be controlled by p53, a p53-independent mechanism Is also involved. To understand the p53-independent regulation of heat shock-induced p21 expression, we searched the promoter region of p21 gene and found one or two heat shock element (HSE)-like sequences in human, rat, and mouse. Electromobility shift assay (EMSA) showed that heat shock factor (HSF) could bind to these HSE-like sequences In response to heat shock, even though to a lesser extent than to HSE. In addition, p21 promoter deletion analysis revealed that heat shock activated a p21 deletion promoter construct containing the HSE-like sequences but lacking p53-binding sites, but not a promoter construct containing neither HSE-like sequences nor the p53-responsive element. Furthermore, the p21 induction by heat shook was significantly inhibited in confluent cells in which heat shock-induced HSF activation was reduced. These results suggest that the transcriptional regulation of p21 by heat shock may be mediated through activation and binding to HSE-like sequences of HSF.

• Archives of Pharmacal Research
• /
• 제25권2호
• /
• pp.208-213
• /
• 2002

The human polyomavirus JC virus is the etiologic agent of progressive multifocal leukoencephalopathy (PML). As the JC virus early promoter directs cell-specific expression of the viral replication factor large T antigen, transcriptional regulation constitutes a major mechanism of glial tropism in PML. It has been demonstrated that SV4O or JC virus large T antigen interacts with p53 protein and regulates many viral and cellular genes. In this study we founts that p53 represses the JC virus early promoter in both glial and nonglial cells To identify the cis-regulatory elements responsible for p53-mediated repression, deletional and site-directed mutational analyses were performed . Deletion of the enhancer region diminished p53-mediated transcriptional repression. However, point mutations of several transcription factor binding sites in the basal promoter region did not produce any significant changes. In support of this observation, when the enhancer was fused to a heterologous promoter, p53 red reduced the promoter activity about three fold. These results indicate that the enhancer region is important for tole repression of JC virus transcription by p53. Furthermore, coexpression of JC virus T antigen with a p53 protein abolished p53-mediated repression of the JC virus early promoter in non-glial cells, but not in glial cells. This finding suggests that T antigen interacts with p53 and regulates JC virus transcription in a cell-specific manner.

• Pediatric Gastroenterology, Hepatology & Nutrition
• /
• 제5권1호
• /
• pp.39-50
• /
• 2002

Hepatitis B viral infection which affect about 10% of Korean population manifests asymptomatic carrier, chronic hepatitis and liver cirrhosis and even associates with hepatocellular carcinoma. Clinical manifestations induced by hepatitis B virus vary depending on the degree of immune response by cytotoxic T cells against viral epitope-presenting liver cells. Since hepatitis B virus presents high rate of mutaton that might change the presented epitope and eventually alter immune response, viral mutations, especially in promoters and enhancers, have an important implication in hepatic inflammation and viral replication. To identify mutations related to the hepatic inflammation, we investigated sequence variations of hepatitis B viral promotor regions in the presence or absence of symptoms in hepatitis B carriers. For this, sera from persistently hepatitis B virus-infected mother-child pairs were collected. After PCR amplifiation of all hepatitis B viral promoters (C promoter, S1 promoter, S2/S promoter, X promoter) using serum DNA from each pair, viral promotors were sequenced by automatic sequencer and then sequence data were analyzed by ClustalW. In most cases, the dominant type of maternal virus was transmitted to the child. However, in some children, some new host specific viral variants could be observed in Cp, S1p and S2/Sp. The mutations in C promoter did not seem to be vertically transmitted but arose in new host independently after the wild type had been transmitted. Enhancer I containing X promoter revealed high host specific variations as has been reported before. Two S promoters, S1p and S2/Sp, have shown some point mutations in children, but no deletion mutations were detected as in chronic hepatitis patients in whom deletion mutations are frequently found. In conclusion, the children with the vertically transmitted hepatitis B virus mostly retain the dominant type virus that had been transmitted. However, host specific variants tended to accumulate over time, possibly as clinical symptoms develop.

• Molecules and Cells
• /
• 제26권2호
• /
• pp.131-139
• /
• 2008

Expression of the seven open reading frames (ORFs) of single-stranded DNA Curtoviruses such as Beet curly top virus (BCTV) and Beet severe curly top virus (BSCTV) is driven by a bi-directional promoter. To investigate this bidirectional promoter activity with respect to viral late gene expression, transgenic Arabidopsis plants expressing a GUS reporter gene under the control of either the BCTV or BSCTV bi-directional promoter were constructed. Transgenic plants harboring constructs showed higher expression levels when the promoter of the less virulent BCTV was used than when the promoter of the more virulent BSCTV was used. In transgenic seedlings, the reporter gene constructs were expressed primarily in actively dividing tissues such as root tips and apical meristems. As the transgenic plants matured, reporter gene expression diminished but viral infection of mature transgenic plants restored reporter gene expression, particularly in transgenic plants containing BCTV virion-sense gene promoter constructs. A 30 base pair conserved late element (CLE) motif was identified that was present three times in tandem in the BCTV promoter and once in that of BSCTV. Progressive deletion of these repeats from the BCTV promoter resulted in decreased reporter gene expression, but BSCTV promoters in which one or two extra copies of this motif were inserted did not exhibit increased late gene promoter activity. These results demonstrate that Curtovirus late gene expression by virion-sense promoters depends on the developmental stage of the host plant as well as on the number of CLE motifs present in the promoter.