• The Plant Pathology Journal
• /
• v.33 no.5
• /
• pp.458-466
• /
• 2017

Xanthomonas oryzae pv. oryzae (Xoo), the causative agent of bacterial blight, is a major threat to rice productivity. Here, we performed RNA-Seq based transcriptomic analysis of Xoo transcripts isolated under in planta growth (on both susceptible and resistant hosts) and in vitro culture conditions. Our in planta extraction method resulted in successful enrichment of Xoo cells and provided RNA samples of high quality. A total of 4,619 differentially expressed genes were identified between in planta and in vitro growth conditions. The majority of the differentially expressed genes identified under in planta growth conditions were related to the nutrient transport, protease activity, stress tolerance, and pathogenicity. Among them, over 1,300 differentially expressed genes were determined to be secretory, including 184 putative type III effectors that may be involved in Xoo pathogenicity. Expression pattern of some of these identified genes were further validated by semi-quantitative RT-PCR. Taken together, these results provide a transcriptome overview of Xoo under in planta and in vitro growth conditions with a focus on its pathogenic processes, deepening our understanding of the behavior and pathogenicity of Xoo.

• Journal of Microbiology
• /
• v.39 no.1
• /
• pp.56-61
• /
• 2001

Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.

• Journal of Korean Physical Therapy Science
• /
• v.7 no.2
• /
• pp.615-628
• /
• 2000

This report is to study on the progress on which foot arch and planta has been changed according to body type based on 4 tilting of scapular & ilium. This study has been carried out to help contribute to some basic information like these. One was to find out how to assess and analysize the deformity of feet and ankle joint which may have the most impact on ideal alignment of anatomical posture. The other was to figure out how to diagnose and treat the deformity to get to the restoration. The results of this study is as followings; 1. The findings which had been made from 22 persons(50%) having left scapular and ilium forward tilt are as follows. 1) On the longitudinal length of the planta left parts of 18 persons(82%) are longer than the right one. On the transversel length of the planta right parts of 17 persons(77%) are longer than the left one. 2) On the size of medial longitudinal arch the left parts of 20 persons(91%) are more wider than the right one. 3) On the sign of supinated foot, the left parts of 18 persons(82%) are more common than the right one. 4) On the thickness of big toe, the left parts of 14 persons(64%) are thicker than the right one. 2. The findings which had been made from 15 persons(34%) having right scapular and ilium forward tilt are as follows. 1) On the longitudinal length of the planta right parts of 11 persons(73%) are longer than the left one. On the transversel length of the planta left parts of 13 persons(87%) are longer than the right one. 2) On the size of medial longitudinal arch the right parts of 13 persons(87%) are more wider than the left one. 3) On the sign of supinated foot, the right parts of 12 persons(80%) are more common than the left one. 4) On the thickness of big toe, the right parts of 7 persons(47%) are thicker than the left one. 3. The findings which had been made from 3 persons(7%) having left scapular and right ilium forward tilt are as follows. 1) On the longitudinal length of the planta right parts of 2 persons(67%) are longer than the left one. On the transversel length of the planta left parts of 2 persons(67%) are longer than the right one. 2) On the size of medial longitudinal arch the right parts of 3 persons(100%) are more wider than the left one. 3) On the sign of supinated foot, the right parts of 2 persons(67%) are more common than the left one. 4) On the thickness of big toe, the left parts of 2 persons(67%) are thicker than the right one. 4. The findings which had been made from 4 persons(9%) having right scapular and left ilium forward tilt are as follows. 1) On the longitudinal length of the planta left parts of 3 persons(75%) are longer than the right one. On the transversel length of the planta right parts of 2 persons(50%) are longer than the left one. 2) On the size of medial longitudinal arch the left parts of 3 persons(75%) are more wider than the right one. 3) On the sign of supinated foot, the left parts of 3 persons(75%) are more common than the right one. 4) On the thickness of big toe, the left parts of 3 persons(75%) are thicker than the right one.

• Research in Plant Disease
• /
• v.21 no.3
• /
• pp.222-226
• /
• 2015

The chitinase-producing bacterial strain C-1 is one of the key chitinase-producing biocontrol agents used for effective bioformulations for biological control. These bioformulations are mixed cultures of various chitinolytic bacteria. However, the precise identification, biocontrol activity, and the underlying mechanisms of the strain C-1 have not been investigated so far. Therefore, we evaluated in planta biocontrol efficacies of C-1 and determined the draft genome sequence of the strain in this study. The bacterial C-1 strain was identified as a novel Serratia sp. by a phylogenic analysis of its 16S rRNA sequence. The Serratia sp. C-1 bacterial cultures showed strong in planta biocontrol efficacies against some major phytopathogenic fungal diseases. The draft genome sequence of Serratia sp. C-1 indicated that the C-1 strain is a novel strain harboring a subset of genes that may be involved in its biocontrol activities.

• The Korean Journal of Zoology
• /
• v.16 no.1
• /
• pp.5-12
• /
• 1973

著者들은 1968, 1971 및 1972년의 3個年間 소백산에서 採集한 지렁이 총 1,850個體를 調査 整理한 결과 Pheretima agrestis, Ph. gucheonensis, Ph. hilgendorfi, Ph. jiriensis, Ph. koreana, Ph. soulensis 및 Ph. susakii patina 의 7기지종과 신종 Ph. planta 와 Ph. sopaikensis 등 총 1屬 9種을 얻었다. 신종 Ph. planta는 체장 105mm., 체폭 5.5mm., 체절수 101개이며, spermathecal pore 2雙으로서 vi체절과 vii 체절 腹面 setal line 바로 위에 位置한다. 또 male pore region의 양모에 있어서 뚜렷한 特徵을 나타내고 있다. 신종 Ph. sopaikensis 는 기지종인 Ph. koreana 다음으로 많은 수가 채집되었으며 체장 80mm., 체폭 4.5mm., 체절수 82개이며 spermathecal pore는 2雙으로서 5/6, 6/7에 位置한다. 특히 xviii 체절 male pore 사이에 雙을 이 불규칙적인 모양의 genital patches 는 본종의 특징이다.

• Proceedings of the Korean Society of Crop Science Conference
• /
• 2023.04a
• /
• pp.129-129
• /
• 2023

• Proceedings of the Korean Society of Potoscience Conference
• /
• 2002.06a
• /
• pp.59-59
• /
• 2002

• Proceedings of the Botanical Society of Korea Conference
• /
• 2002.04a
• /
• pp.98-98
• /
• 2002

• Journal of the Korean Society for Precision Engineering
• /
• v.29 no.1
• /
• pp.25-32
• /
• 2012

In this study, we present a gripping mechanism that is inspired by caterpillar's proleg. A caterpillar's proleg has planta that gives compliance to the proleg by greatly deforming its shape. In the bio-inspired gripper, the planta is implemented by flexure joints. The flexures buckle when end force and end moment is applied on the joint in opposite direction. Using this characteristic, the gripping structure is designed so that the flexure buckling can occur. Flexure buckling increases the region where gripping force is constant and this region leads to increasing in gripping range. At the same time, flexure buckling decouples all spines and therefore all spines can move differentially and independently. With this simple but effective mechanism, the bioinspire gripper can achieve adaptive gripping on rough and rugged surfaces. A prototype is built to demonstrate adaptive gripping on rough and rugged surfaces such as cement block, brick.

• Journal of Plant Biotechnology
• /
• v.40 no.2
• /
• pp.59-64
• /
• 2013

Auxin is a key plant hormone which regulates overall plant growth development. A number of researches to investigate auxin signaling identified three major classes of early auxin response genes: AUX/IAA, GH3 and SMALL AUXIN UP RNA (SAUR). Among these genes, in planta functions of SAUR gene family are largely ambiguous, while both AUX/IAA and GH3 genes are analyzed to mediate negative feedback on auxin response. SAUR genes encode small plant-specific proteins. SAUR gene products are highly unstable and transiently expressed in the tissue- and developmental-specific manners in response to auxin and various environmental stimuli. In the decades, molecular and genetic approaches to elucidate in planta functions of SAURs have been hampered by several factors such as the unstable molecular features and functional redundancy among them. However, a series of recent studies focusing on several subgroups of SAUR gene family made significant progress in our understanding of its biochemical and physiological functions. These works suggest that many SAUR proteins mainly regulate auxin-related cell expansion and auxin transport. In this review, the recent progress in SAUR research and prospects for crop improvement through its genetic manipulation are discussed.