• Korean Journal of Biological Psychiatry
• /
• v.8 no.2
• /
• pp.203-207
• /
• 2001

The genome sequencing project has generated and will continue to generate enormous amounts of sequence data including 5 eukaryotic and about 60 prokaryotic genomes. Given this ever-increasing amounts of sequence information, new strategies are necessary to efficiently pursue the next phase of the genome project-the elucidation of gene expression patterns and gene product function on a whole genome scale. In order to assign functional information to the genome sequence, DNA chip(or gene microarray) technology was developed to efficiently identify the differential expression pattern of independent biological samples. DNA chip provides a new tool for genome expression analysis that may revolutionize many aspects of biotechnology including new drug discovery and disease diagnostics.

• Animal cells and systems
• /
• v.1 no.2
• /
• pp.345-350
• /
• 1997

The ${\beta}$-Lactoglobulin (BLG) gene expression is differentially regulated during development of the mammary tissues. Such differential regulation of the BLG gene expression can be reiterated in the cultured mammary HC11 cells. In the growing non-confluent HC11 cells, the BLG promoter activity was shown to be partially repressed by the upstream regulatory sequence. The repression was gradually diminished and switched to activation as the cells grew confluent. The differential regulation of the BLG promoter was controlled by the 5'-regulatory sequence located at the upstream of 205 bp. Electromobility shift assay showed that nuclear extract from HC11 cells differentially bound on the regulatory sequence, depending on the cell confluency, which was in accordance with the differential transcriptional activity. DNase I foot-print assay, however, revealed that all nuclear extracts presented the same foot-prints, regardless of confluency of HC11 cells. These results suggest that differential regulation BLG gene expression by the 5'-regulatory sequence may be accomplished by competitive and/or cooperative binding of differential regulatory factors on the same regulatory element.

• Korean Journal of Food Science and Technology
• /
• v.32 no.6
• /
• pp.1331-1335
• /
• 2000

The WL6 strain isolated from Kimchi could not be made scientific name because it was identified as three species, i.e., Leuconostoc mesenternides ssp cremoris, Leu. mesenteroides ssp. dextranicum or Lactobacillus bifermentans when it was tested by API kit or Biolog system methods. The unidentifiable WL6 strain was finally reclassified as Lactobacillus bifermentans by genetic identification using two PCR-based specific sequence primer sets which were originated from homologous pepN and 16S rRNA genes.

• Korean Journal of Microbiology
• /
• v.24 no.3
• /
• pp.204-210
• /
• 1986

One clone(pANt32) carring tRNA/sup Arg/ gene was selected from Aspergillus total tRNA gene clones. The nucleotide sequences of this tRNA gene were determined by Maxam and Gilbert's chemical cleavage methods. The sequence of this tRNA gene is as follow; 5'GGCCGGCTGCCCAATTGGCAAGGCGTCTGACTACGAATCAGGAGAT TGCAGGTTCGAGCCCTGCGTGGGTCA3'. This sequence conicides with the characteristecs of other eukaryotic tRNA. Some consensus sequences (ACT-TA bow, TATTTT and T-cluster) are found in both 5'-end and 3'-end flanking regions.

• Microbiology and Biotechnology Letters
• /
• v.22 no.2
• /
• pp.134-142
• /
• 1994

The neucleotide sequences of the xylA gene encoding $\beta $-xylosidase of Bacillus stearothermophilus and is its flanking regions were datermined. Three open reading frame(ORFs) were found, one of which(ORF1) appeared to code for the $\beta $-xylosidase. The 1830 base pair ORF1 encoded 609 amino acids starting from a TTG initiation codon. The molecular weight deduced from the nucleotide sequence(68 KD) was in agreement with that estimated by SDS-polyacrylamide gel electrophoresis of the purified enzyme(66 KD). The Shine-Dalgarno sequence(5'-AGGAGG-3') was found 11 bp upstream of the initiation codon. Further 15 bp upstream, there observed a potential transcription initiation signals. The putative -10 sequence(CATAAT) and -35 sequence(TTGTTA) coresponded closely to the consensus sequences for Bacillus subtilis RNA polymerase with major sigma factor. The guanine-plus-cytosine content of the coding region of the xylA gene was 56mol% while that of the third position of the codons was 63 mol%. Based on the comparison with the amino acid sequences of several other carbohydrate degrading enzymes, two conserved regions, possibly participating in the catalytic mechamism of $\beta $-xylosidase xylA, were identified in 278-298 and 329-350 regions of the translated xylA gene. The nucleotide sequence of the xylA was found to exhibit no homology to any other genes so far reproted.

• Mycobiology
• /
• v.41 no.1
• /
• pp.37-41
• /
• 2013

Laccases (EC 1.10.3.2) are copper-containing polyphenol oxidases found in white-rot fungi. Here, we report the cloning and analysis of the nucleotide sequence of a new laccase gene, fvlac7, based on the genomic sequence of Flammulina velutipes. A primer set was designed from the putative mRNA that was aligned to the genomic DNA of F. velutipes. A cDNA fragment approximately 1.6-kb long was then amplified by reverse transcriptase-PCR using total RNA, which was subsequently cloned and sequenced. The cDNA sequence of fvlac7 was then compared to that of the genomic DNA, and 16 introns were found in the genomic DNA sequence. The fvlac7 protein, which consists of 538 amino acids, showed only 42~51% identity with 12 different mushroom species containing two laccases of F. velutipes, suggesting the fvlac7 is a novel laccase gene. The first 25 amino acids of Fvlac7 correspond to a predicted signal sequence, four copper-binding sites, and four N-glycosylation sites. Fvlac7 cDNA was heterologously overexpressed in an Escherichia coli system with an approximate expected molecular weight of 60 kDa.

• Animal cells and systems
• /
• v.3 no.3
• /
• pp.295-301
• /
• 1999

The nucleotide sequence of a 447 base pair fragment in the mitochondrial cytochrome b gene and the complete sequence of the mitochondrial 12S ribosomal RNA gene, 938 bp, were analyzed to infer inter- and intraspecific genetic relationships of Hyla japonica and H. suweonensis from Korea and H, japonica from Japan. In the mitochondrial cytochrome b gene, genetic differentiation among H. japonica populations were 9.62% and 15.66% between H. japonica and H. suweonensis. Based on the Tamura-Nei distance, the level of sequence divergence ranged from 0.45% to 2.75% within Korean H. japonica, while 8.31%-8.87% between Korean and Japanese H. japonica and 11.51%-12.46% between H. japonica and H. suweonensis. In the neigh-bor-joining tree, Korean populations of H. japonica were clustered first at 2.22% and followed by Japanese H. japonica and H. suweonensis at 8.51% and 12.29%, respectively. In mitochondrial 12S rRNA gene, genetic differentiation between H. japonica and H. suweonensis nras 7.17% (68 bp) including 7 gaps. Based on Tamura-Nei distance, the level of sequence divergence ranged 3.53% between Korean and Japanese H. japonica and from 4.93% to 5.41% between H. japonica and H. suweonensis. Phenogram pattern of the 12S rRNA gene sequence corresponded with that of the mitochondrial cytochrome b gene.

• Journal of Microbiology and Biotechnology
• /
• v.3 no.4
• /
• pp.224-231
• /
• 1993

The nucleotide sequence of the xylanase gene (xynY) from alkalophilic Bacillus sp. YC-335 was determined and analyzed. An open reading frame of 1, 062 base pairs for xynY gene was observed and encoded for a protein of 354 amino acids with a molecular weight of 38, 915. S1 nuclease mapping showed that the transcription initiation sites of the xynY gene were different in Bacillus sp. YC-335 and Escherichia coli HB101 (pYS55). S1 mapping also showed that -10 region of the xynY gene recognized by RNA polymerases of E. coli and Bacillus sp. YC-335 were TACAGT and TATGAT , respectively. A ribosome binding site sequence with the free energy of -17.0 Kcal/mol was observed 9 base pairs upstream from the unusual initiation codon, TTG. The proposed signal sequence consisted of 27 amino acids, 2 of which were basic amino acid residues and 21 were hydrophobic amino acid residues. When the amino acid sequences of xylanases were compared, Bacillus sp. YC-335 xylanase showed more than 50% homology with xylanases from B. pumilus, B. subtilis, and B. circulans.

• Journal of Life Science
• /
• v.8 no.6
• /
• pp.673-680
• /
• 1998

Adenosine deaminase gene from Nocardioides sp. J-326TK was cloned by polymerase chain reaction using primers (PI, PII and PIII) constructed from the highly conserved amino acid sequences among Escherichia coli, mouse and human. A PCR product of about 800bp, as expected from the sequence of E. coli adenosine deaminase gene, was obtained from Nocardioides sp. J-326TK chromosomal DNA double-digested with EcoRI and Pst I. DNA sequencing of the PCR product after cloning into pT7Blue T-vector shows 99.5% and 98.9% homologies in nucleotide and amino acid sequences, respectively, with the E. coli adenosine deaminase whereas 59.5% and 46.8% homologies with the human adenosine deaminase, indicating the evolutionarily relationship of these organisms.

• Journal of Microbiology and Biotechnology
• /
• v.8 no.3
• /
• pp.214-221
• /
• 1998

A Brevibacterium ammoniagenes gene coding for glucose/mannose-specific enzyme II ($EII^{Glc}$) of the phosphoenolpyruvate-dependent phosphotransferase system (PTS) was cloned by complementing an Escherichia coli mutation affecting a ptsG gene, and the complete DNA nucleotide sequence was determined. The cloned gene was identified to be a ptsG, which enables the E. coli transportment to use glucose more efficiently than mannose as the sole carbon source in an M9 minimal medium. The ptsG gene of B. ammoniagenes consists of an open reading frame of 1,983 nucleotides putatively encoding a polypeptide of 661 amino acid residues and a TAA stop codon. The deduced amino acid sequence of the B. ammoniagenes $EII^{Glc}$ shows, at $46\%$, the highest degree of sequence similarity with the Corynebacterium glutamicum EII specific for both glucose and mannose. In addition, the $EII^{Glc}$ shares approximately $30\%$ sequence similarities with sucrose-specific and ${\beta}$-glucoside-specific EIIs of the several bacteria belonging to the glucose-PTS class. The 161-amino-acid C-terminal sequence of $EII^{Glc}$ is also similar to that of E. coli enzyme $IIA^{Glc}$, specific for glucose ($EIIA^{Glc}$). The B. ammoniagenes $EII^{Glc}$ consists of three domains; a hydrophobic region (EIIC) and two hydrophilic regions (EIIA, EIIB). The arrangement of structural domains, IIBCA, of the $EII^{Glc}$ is identical to those of EIIs specific for sucrose or ${\beta}$-glucoside. While the domain IIA was removed from the B. ammoniagenes $EII^{Glc}$ the remaining domains IIBC were found to restore the glucose and mannose-utilizing capacity of E. coli mutant lacking $EII^{Glc}$ activity with $EIIA^{Glc}$ of the E. coli mutant. $EII^{Glc}$ contains a histidine residue and a cysteine residue which are putative phosphorylation sites for the protein.