The genome sequencing project has generated and will continue to generate enormous amounts of sequence data including 5 eukaryotic and about 60 prokaryotic genomes. Given this ever-increasing amounts of sequence information, new strategies are necessary to efficiently pursue the next phase of the genome project-the elucidation of gene expression patterns and gene product function on a whole genome scale. In order to assign functional information to the genome sequence, DNA chip(or gene microarray) technology was developed to efficiently identify the differential expression pattern of independent biological samples. DNA chip provides a new tool for genome expression analysis that may revolutionize many aspects of biotechnology including new drug discovery and disease diagnostics.
The ${\beta}$-Lactoglobulin (BLG) gene expression is differentially regulated during development of the mammary tissues. Such differential regulation of the BLG gene expression can be reiterated in the cultured mammary HC11 cells. In the growing non-confluent HC11 cells, the BLG promoter activity was shown to be partially repressed by the upstream regulatory sequence. The repression was gradually diminished and switched to activation as the cells grew confluent. The differential regulation of the BLG promoter was controlled by the 5'-regulatory sequence located at the upstream of 205 bp. Electromobility shift assay showed that nuclear extract from HC11 cells differentially bound on the regulatory sequence, depending on the cell confluency, which was in accordance with the differential transcriptional activity. DNase I foot-print assay, however, revealed that all nuclear extracts presented the same foot-prints, regardless of confluency of HC11 cells. These results suggest that differential regulation BLG gene expression by the 5'-regulatory sequence may be accomplished by competitive and/or cooperative binding of differential regulatory factors on the same regulatory element.
The WL6 strain isolated from Kimchi could not be made scientific name because it was identified as three species, i.e., Leuconostoc mesenternides ssp cremoris, Leu. mesenteroides ssp. dextranicum or Lactobacillus bifermentans when it was tested by API kit or Biolog system methods. The unidentifiable WL6 strain was finally reclassified as Lactobacillus bifermentans by genetic identification using two PCR-based specific sequence primer sets which were originated from homologous pepN and 16S rRNA genes.
One clone(pANt32) carring tRNA/sup Arg/ gene was selected from Aspergillus total tRNA gene clones. The nucleotide sequences of this tRNA gene were determined by Maxam and Gilbert's chemical cleavage methods. The sequence of this tRNA gene is as follow; 5'GGCCGGCTGCCCAATTGGCAAGGCGTCTGACTACGAATCAGGAGAT TGCAGGTTCGAGCCCTGCGTGGGTCA3'. This sequence conicides with the characteristecs of other eukaryotic tRNA. Some consensus sequences (ACT-TA bow, TATTTT and T-cluster) are found in both 5'-end and 3'-end flanking regions.
The neucleotide sequences of the xylA gene encoding $\beta $-xylosidase of Bacillus stearothermophilus and is its flanking regions were datermined. Three open reading frame(ORFs) were found, one of which(ORF1) appeared to code for the $\beta $-xylosidase. The 1830 base pair ORF1 encoded 609 amino acids starting from a TTG initiation codon. The molecular weight deduced from the nucleotide sequence(68 KD) was in agreement with that estimated by SDS-polyacrylamide gel electrophoresis of the purified enzyme(66 KD). The Shine-Dalgarno sequence(5'-AGGAGG-3') was found 11 bp upstream of the initiation codon. Further 15 bp upstream, there observed a potential transcription initiation signals. The putative -10 sequence(CATAAT) and -35 sequence(TTGTTA) coresponded closely to the consensus sequences for Bacillus subtilis RNA polymerase with major sigma factor. The guanine-plus-cytosine content of the coding region of the xylA gene was 56mol% while that of the third position of the codons was 63 mol%. Based on the comparison with the amino acid sequences of several other carbohydrate degrading enzymes, two conserved regions, possibly participating in the catalytic mechamism of $\beta $-xylosidase xylA, were identified in 278-298 and 329-350 regions of the translated xylA gene. The nucleotide sequence of the xylA was found to exhibit no homology to any other genes so far reproted.
Laccases (EC 1.10.3.2) are copper-containing polyphenol oxidases found in white-rot fungi. Here, we report the cloning and analysis of the nucleotide sequence of a new laccase gene, fvlac7, based on the genomic sequence of Flammulina velutipes. A primer set was designed from the putative mRNA that was aligned to the genomic DNA of F. velutipes. A cDNA fragment approximately 1.6-kb long was then amplified by reverse transcriptase-PCR using total RNA, which was subsequently cloned and sequenced. The cDNA sequence of fvlac7 was then compared to that of the genomic DNA, and 16 introns were found in the genomic DNA sequence. The fvlac7 protein, which consists of 538 amino acids, showed only 42~51% identity with 12 different mushroom species containing two laccases of F. velutipes, suggesting the fvlac7 is a novel laccase gene. The first 25 amino acids of Fvlac7 correspond to a predicted signal sequence, four copper-binding sites, and four N-glycosylation sites. Fvlac7 cDNA was heterologously overexpressed in an Escherichia coli system with an approximate expected molecular weight of 60 kDa.
Jung Eun Lee;Dong Eun Yang;Yu Ri Kim;Hyuk Lee;Hyun Ick Lee;Suh-Yung Yang;Hei Yung Lee
Animal cells and systems
/
v.3
no.3
/
pp.295-301
/
1999
The nucleotide sequence of a 447 base pair fragment in the mitochondrial cytochrome b gene and the complete sequence of the mitochondrial 12S ribosomal RNA gene, 938 bp, were analyzed to infer inter- and intraspecific genetic relationships of Hyla japonica and H. suweonensis from Korea and H, japonica from Japan. In the mitochondrial cytochrome b gene, genetic differentiation among H. japonica populations were 9.62% and 15.66% between H. japonica and H. suweonensis. Based on the Tamura-Nei distance, the level of sequence divergence ranged from 0.45% to 2.75% within Korean H. japonica, while 8.31%-8.87% between Korean and Japanese H. japonica and 11.51%-12.46% between H. japonica and H. suweonensis. In the neigh-bor-joining tree, Korean populations of H. japonica were clustered first at 2.22% and followed by Japanese H. japonica and H. suweonensis at 8.51% and 12.29%, respectively. In mitochondrial 12S rRNA gene, genetic differentiation between H. japonica and H. suweonensis nras 7.17% (68 bp) including 7 gaps. Based on Tamura-Nei distance, the level of sequence divergence ranged 3.53% between Korean and Japanese H. japonica and from 4.93% to 5.41% between H. japonica and H. suweonensis. Phenogram pattern of the 12S rRNA gene sequence corresponded with that of the mitochondrial cytochrome b gene.
Park, Young-Seo;Yum, Do-Young;Kim, Jin-Man;Bai, Dong-Hoon
Journal of Microbiology and Biotechnology
/
v.3
no.4
/
pp.224-231
/
1993
The nucleotide sequence of the xylanase gene (xynY) from alkalophilic Bacillus sp. YC-335 was determined and analyzed. An open reading frame of 1, 062 base pairs for xynY gene was observed and encoded for a protein of 354 amino acids with a molecular weight of 38, 915. S1 nuclease mapping showed that the transcription initiation sites of the xynY gene were different in Bacillus sp. YC-335 and Escherichia coli HB101 (pYS55). S1 mapping also showed that -10 region of the xynY gene recognized by RNA polymerases of E. coli and Bacillus sp. YC-335 were TACAGT and TATGAT , respectively. A ribosome binding site sequence with the free energy of -17.0 Kcal/mol was observed 9 base pairs upstream from the unusual initiation codon, TTG. The proposed signal sequence consisted of 27 amino acids, 2 of which were basic amino acid residues and 21 were hydrophobic amino acid residues. When the amino acid sequences of xylanases were compared, Bacillus sp. YC-335 xylanase showed more than 50% homology with xylanases from B. pumilus, B. subtilis, and B. circulans.
Adenosine deaminase gene from Nocardioides sp. J-326TK was cloned by polymerase chain reaction using primers (PI, PII and PIII) constructed from the highly conserved amino acid sequences among Escherichia coli, mouse and human. A PCR product of about 800bp, as expected from the sequence of E. coli adenosine deaminase gene, was obtained from Nocardioides sp. J-326TK chromosomal DNA double-digested with EcoRI and Pst I. DNA sequencing of the PCR product after cloning into pT7Blue T-vector shows 99.5% and 98.9% homologies in nucleotide and amino acid sequences, respectively, with the E. coli adenosine deaminase whereas 59.5% and 46.8% homologies with the human adenosine deaminase, indicating the evolutionarily relationship of these organisms.
A Brevibacterium ammoniagenes gene coding for glucose/mannose-specific enzyme II ($EII^{Glc}$) of the phosphoenolpyruvate-dependent phosphotransferase system (PTS) was cloned by complementing an Escherichia coli mutation affecting a ptsG gene, and the complete DNA nucleotide sequence was determined. The cloned gene was identified to be a ptsG, which enables the E. coli transportment to use glucose more efficiently than mannose as the sole carbon source in an M9 minimal medium. The ptsG gene of B. ammoniagenes consists of an open reading frame of 1,983 nucleotides putatively encoding a polypeptide of 661 amino acid residues and a TAA stop codon. The deduced amino acid sequence of the B. ammoniagenes $EII^{Glc}$ shows, at $46\%$, the highest degree of sequence similarity with the Corynebacterium glutamicum EII specific for both glucose and mannose. In addition, the $EII^{Glc}$ shares approximately $30\%$ sequence similarities with sucrose-specific and ${\beta}$-glucoside-specific EIIs of the several bacteria belonging to the glucose-PTS class. The 161-amino-acid C-terminal sequence of $EII^{Glc}$ is also similar to that of E. coli enzyme $IIA^{Glc}$, specific for glucose ($EIIA^{Glc}$). The B. ammoniagenes $EII^{Glc}$ consists of three domains; a hydrophobic region (EIIC) and two hydrophilic regions (EIIA, EIIB). The arrangement of structural domains, IIBCA, of the $EII^{Glc}$ is identical to those of EIIs specific for sucrose or ${\beta}$-glucoside. While the domain IIA was removed from the B. ammoniagenes $EII^{Glc}$ the remaining domains IIBC were found to restore the glucose and mannose-utilizing capacity of E. coli mutant lacking $EII^{Glc}$ activity with $EIIA^{Glc}$ of the E. coli mutant. $EII^{Glc}$ contains a histidine residue and a cysteine residue which are putative phosphorylation sites for the protein.
본 웹사이트에 게시된 이메일 주소가 전자우편 수집 프로그램이나
그 밖의 기술적 장치를 이용하여 무단으로 수집되는 것을 거부하며,
이를 위반시 정보통신망법에 의해 형사 처벌됨을 유념하시기 바랍니다.
[게시일 2004년 10월 1일]
이용약관
제 1 장 총칙
제 1 조 (목적)
이 이용약관은 KoreaScience 홈페이지(이하 “당 사이트”)에서 제공하는 인터넷 서비스(이하 '서비스')의 가입조건 및 이용에 관한 제반 사항과 기타 필요한 사항을 구체적으로 규정함을 목적으로 합니다.
제 2 조 (용어의 정의)
① "이용자"라 함은 당 사이트에 접속하여 이 약관에 따라 당 사이트가 제공하는 서비스를 받는 회원 및 비회원을
말합니다.
② "회원"이라 함은 서비스를 이용하기 위하여 당 사이트에 개인정보를 제공하여 아이디(ID)와 비밀번호를 부여
받은 자를 말합니다.
③ "회원 아이디(ID)"라 함은 회원의 식별 및 서비스 이용을 위하여 자신이 선정한 문자 및 숫자의 조합을
말합니다.
④ "비밀번호(패스워드)"라 함은 회원이 자신의 비밀보호를 위하여 선정한 문자 및 숫자의 조합을 말합니다.
제 3 조 (이용약관의 효력 및 변경)
① 이 약관은 당 사이트에 게시하거나 기타의 방법으로 회원에게 공지함으로써 효력이 발생합니다.
② 당 사이트는 이 약관을 개정할 경우에 적용일자 및 개정사유를 명시하여 현행 약관과 함께 당 사이트의
초기화면에 그 적용일자 7일 이전부터 적용일자 전일까지 공지합니다. 다만, 회원에게 불리하게 약관내용을
변경하는 경우에는 최소한 30일 이상의 사전 유예기간을 두고 공지합니다. 이 경우 당 사이트는 개정 전
내용과 개정 후 내용을 명확하게 비교하여 이용자가 알기 쉽도록 표시합니다.
제 4 조(약관 외 준칙)
① 이 약관은 당 사이트가 제공하는 서비스에 관한 이용안내와 함께 적용됩니다.
② 이 약관에 명시되지 아니한 사항은 관계법령의 규정이 적용됩니다.
제 2 장 이용계약의 체결
제 5 조 (이용계약의 성립 등)
① 이용계약은 이용고객이 당 사이트가 정한 약관에 「동의합니다」를 선택하고, 당 사이트가 정한
온라인신청양식을 작성하여 서비스 이용을 신청한 후, 당 사이트가 이를 승낙함으로써 성립합니다.
② 제1항의 승낙은 당 사이트가 제공하는 과학기술정보검색, 맞춤정보, 서지정보 등 다른 서비스의 이용승낙을
포함합니다.
제 6 조 (회원가입)
서비스를 이용하고자 하는 고객은 당 사이트에서 정한 회원가입양식에 개인정보를 기재하여 가입을 하여야 합니다.
제 7 조 (개인정보의 보호 및 사용)
당 사이트는 관계법령이 정하는 바에 따라 회원 등록정보를 포함한 회원의 개인정보를 보호하기 위해 노력합니다. 회원 개인정보의 보호 및 사용에 대해서는 관련법령 및 당 사이트의 개인정보 보호정책이 적용됩니다.
제 8 조 (이용 신청의 승낙과 제한)
① 당 사이트는 제6조의 규정에 의한 이용신청고객에 대하여 서비스 이용을 승낙합니다.
② 당 사이트는 아래사항에 해당하는 경우에 대해서 승낙하지 아니 합니다.
- 이용계약 신청서의 내용을 허위로 기재한 경우
- 기타 규정한 제반사항을 위반하며 신청하는 경우
제 9 조 (회원 ID 부여 및 변경 등)
① 당 사이트는 이용고객에 대하여 약관에 정하는 바에 따라 자신이 선정한 회원 ID를 부여합니다.
② 회원 ID는 원칙적으로 변경이 불가하며 부득이한 사유로 인하여 변경 하고자 하는 경우에는 해당 ID를
해지하고 재가입해야 합니다.
③ 기타 회원 개인정보 관리 및 변경 등에 관한 사항은 서비스별 안내에 정하는 바에 의합니다.
제 3 장 계약 당사자의 의무
제 10 조 (KISTI의 의무)
① 당 사이트는 이용고객이 희망한 서비스 제공 개시일에 특별한 사정이 없는 한 서비스를 이용할 수 있도록
하여야 합니다.
② 당 사이트는 개인정보 보호를 위해 보안시스템을 구축하며 개인정보 보호정책을 공시하고 준수합니다.
③ 당 사이트는 회원으로부터 제기되는 의견이나 불만이 정당하다고 객관적으로 인정될 경우에는 적절한 절차를
거쳐 즉시 처리하여야 합니다. 다만, 즉시 처리가 곤란한 경우는 회원에게 그 사유와 처리일정을 통보하여야
합니다.
제 11 조 (회원의 의무)
① 이용자는 회원가입 신청 또는 회원정보 변경 시 실명으로 모든 사항을 사실에 근거하여 작성하여야 하며,
허위 또는 타인의 정보를 등록할 경우 일체의 권리를 주장할 수 없습니다.
② 당 사이트가 관계법령 및 개인정보 보호정책에 의거하여 그 책임을 지는 경우를 제외하고 회원에게 부여된
ID의 비밀번호 관리소홀, 부정사용에 의하여 발생하는 모든 결과에 대한 책임은 회원에게 있습니다.
③ 회원은 당 사이트 및 제 3자의 지적 재산권을 침해해서는 안 됩니다.
제 4 장 서비스의 이용
제 12 조 (서비스 이용 시간)
① 서비스 이용은 당 사이트의 업무상 또는 기술상 특별한 지장이 없는 한 연중무휴, 1일 24시간 운영을
원칙으로 합니다. 단, 당 사이트는 시스템 정기점검, 증설 및 교체를 위해 당 사이트가 정한 날이나 시간에
서비스를 일시 중단할 수 있으며, 예정되어 있는 작업으로 인한 서비스 일시중단은 당 사이트 홈페이지를
통해 사전에 공지합니다.
② 당 사이트는 서비스를 특정범위로 분할하여 각 범위별로 이용가능시간을 별도로 지정할 수 있습니다. 다만
이 경우 그 내용을 공지합니다.
제 13 조 (홈페이지 저작권)
① NDSL에서 제공하는 모든 저작물의 저작권은 원저작자에게 있으며, KISTI는 복제/배포/전송권을 확보하고
있습니다.
② NDSL에서 제공하는 콘텐츠를 상업적 및 기타 영리목적으로 복제/배포/전송할 경우 사전에 KISTI의 허락을
받아야 합니다.
③ NDSL에서 제공하는 콘텐츠를 보도, 비평, 교육, 연구 등을 위하여 정당한 범위 안에서 공정한 관행에
합치되게 인용할 수 있습니다.
④ NDSL에서 제공하는 콘텐츠를 무단 복제, 전송, 배포 기타 저작권법에 위반되는 방법으로 이용할 경우
저작권법 제136조에 따라 5년 이하의 징역 또는 5천만 원 이하의 벌금에 처해질 수 있습니다.
제 14 조 (유료서비스)
① 당 사이트 및 협력기관이 정한 유료서비스(원문복사 등)는 별도로 정해진 바에 따르며, 변경사항은 시행 전에
당 사이트 홈페이지를 통하여 회원에게 공지합니다.
② 유료서비스를 이용하려는 회원은 정해진 요금체계에 따라 요금을 납부해야 합니다.
제 5 장 계약 해지 및 이용 제한
제 15 조 (계약 해지)
회원이 이용계약을 해지하고자 하는 때에는 [가입해지] 메뉴를 이용해 직접 해지해야 합니다.
제 16 조 (서비스 이용제한)
① 당 사이트는 회원이 서비스 이용내용에 있어서 본 약관 제 11조 내용을 위반하거나, 다음 각 호에 해당하는
경우 서비스 이용을 제한할 수 있습니다.
- 2년 이상 서비스를 이용한 적이 없는 경우
- 기타 정상적인 서비스 운영에 방해가 될 경우
② 상기 이용제한 규정에 따라 서비스를 이용하는 회원에게 서비스 이용에 대하여 별도 공지 없이 서비스 이용의
일시정지, 이용계약 해지 할 수 있습니다.
제 17 조 (전자우편주소 수집 금지)
회원은 전자우편주소 추출기 등을 이용하여 전자우편주소를 수집 또는 제3자에게 제공할 수 없습니다.
제 6 장 손해배상 및 기타사항
제 18 조 (손해배상)
당 사이트는 무료로 제공되는 서비스와 관련하여 회원에게 어떠한 손해가 발생하더라도 당 사이트가 고의 또는 과실로 인한 손해발생을 제외하고는 이에 대하여 책임을 부담하지 아니합니다.
제 19 조 (관할 법원)
서비스 이용으로 발생한 분쟁에 대해 소송이 제기되는 경우 민사 소송법상의 관할 법원에 제기합니다.
[부 칙]
1. (시행일) 이 약관은 2016년 9월 5일부터 적용되며, 종전 약관은 본 약관으로 대체되며, 개정된 약관의 적용일 이전 가입자도 개정된 약관의 적용을 받습니다.