• 생물정신의학
• /
• 제8권2호
• /
• pp.203-207
• /
• 2001

The genome sequencing project has generated and will continue to generate enormous amounts of sequence data including 5 eukaryotic and about 60 prokaryotic genomes. Given this ever-increasing amounts of sequence information, new strategies are necessary to efficiently pursue the next phase of the genome project-the elucidation of gene expression patterns and gene product function on a whole genome scale. In order to assign functional information to the genome sequence, DNA chip(or gene microarray) technology was developed to efficiently identify the differential expression pattern of independent biological samples. DNA chip provides a new tool for genome expression analysis that may revolutionize many aspects of biotechnology including new drug discovery and disease diagnostics.

• Animal cells and systems
• /
• 제1권2호
• /
• pp.345-350
• /
• 1997

The ${\beta}$-Lactoglobulin (BLG) gene expression is differentially regulated during development of the mammary tissues. Such differential regulation of the BLG gene expression can be reiterated in the cultured mammary HC11 cells. In the growing non-confluent HC11 cells, the BLG promoter activity was shown to be partially repressed by the upstream regulatory sequence. The repression was gradually diminished and switched to activation as the cells grew confluent. The differential regulation of the BLG promoter was controlled by the 5'-regulatory sequence located at the upstream of 205 bp. Electromobility shift assay showed that nuclear extract from HC11 cells differentially bound on the regulatory sequence, depending on the cell confluency, which was in accordance with the differential transcriptional activity. DNase I foot-print assay, however, revealed that all nuclear extracts presented the same foot-prints, regardless of confluency of HC11 cells. These results suggest that differential regulation BLG gene expression by the 5'-regulatory sequence may be accomplished by competitive and/or cooperative binding of differential regulatory factors on the same regulatory element.

• 한국식품과학회지
• /
• 제32권6호
• /
• pp.1331-1335
• /
• 2000

김치 젖산균인 WL6는 API kit 또는 Biolog system방법에 의하여 동정한 결과, Leuconostoc mesenteroides ssp. cremoris, Leu. mesenteroides ssp. dextranicum 또는 Lactobacillus bifermentans로 나타나 동정되지 않았다. 그러나, pepN gene과 16S rRNA gene으로부터 2개의 specific-sequence primer set을 제조하여 PCR 방법으로 증폭한 후에 표준균주들과 비교한 결과, WL6는 Lactobacillus bifermentans로 추정되었다.

• 미생물학회지
• /
• 제24권3호
• /
• pp.204-210
• /
• 1986

One clone(pANt32) carring tRNA/sup Arg/ gene was selected from Aspergillus total tRNA gene clones. The nucleotide sequences of this tRNA gene were determined by Maxam and Gilbert's chemical cleavage methods. The sequence of this tRNA gene is as follow; 5'GGCCGGCTGCCCAATTGGCAAGGCGTCTGACTACGAATCAGGAGAT TGCAGGTTCGAGCCCTGCGTGGGTCA3'. This sequence conicides with the characteristecs of other eukaryotic tRNA. Some consensus sequences (ACT-TA bow, TATTTT and T-cluster) are found in both 5'-end and 3'-end flanking regions.

• 한국미생물·생명공학회지
• /
• 제22권2호
• /
• pp.134-142
• /
• 1994

The neucleotide sequences of the xylA gene encoding $\beta $-xylosidase of Bacillus stearothermophilus and is its flanking regions were datermined. Three open reading frame(ORFs) were found, one of which(ORF1) appeared to code for the $\beta $-xylosidase. The 1830 base pair ORF1 encoded 609 amino acids starting from a TTG initiation codon. The molecular weight deduced from the nucleotide sequence(68 KD) was in agreement with that estimated by SDS-polyacrylamide gel electrophoresis of the purified enzyme(66 KD). The Shine-Dalgarno sequence(5'-AGGAGG-3') was found 11 bp upstream of the initiation codon. Further 15 bp upstream, there observed a potential transcription initiation signals. The putative -10 sequence(CATAAT) and -35 sequence(TTGTTA) coresponded closely to the consensus sequences for Bacillus subtilis RNA polymerase with major sigma factor. The guanine-plus-cytosine content of the coding region of the xylA gene was 56mol% while that of the third position of the codons was 63 mol%. Based on the comparison with the amino acid sequences of several other carbohydrate degrading enzymes, two conserved regions, possibly participating in the catalytic mechamism of $\beta $-xylosidase xylA, were identified in 278-298 and 329-350 regions of the translated xylA gene. The nucleotide sequence of the xylA was found to exhibit no homology to any other genes so far reproted.

• Mycobiology
• /
• 제41권1호
• /
• pp.37-41
• /
• 2013

Laccases (EC 1.10.3.2) are copper-containing polyphenol oxidases found in white-rot fungi. Here, we report the cloning and analysis of the nucleotide sequence of a new laccase gene, fvlac7, based on the genomic sequence of Flammulina velutipes. A primer set was designed from the putative mRNA that was aligned to the genomic DNA of F. velutipes. A cDNA fragment approximately 1.6-kb long was then amplified by reverse transcriptase-PCR using total RNA, which was subsequently cloned and sequenced. The cDNA sequence of fvlac7 was then compared to that of the genomic DNA, and 16 introns were found in the genomic DNA sequence. The fvlac7 protein, which consists of 538 amino acids, showed only 42~51% identity with 12 different mushroom species containing two laccases of F. velutipes, suggesting the fvlac7 is a novel laccase gene. The first 25 amino acids of Fvlac7 correspond to a predicted signal sequence, four copper-binding sites, and four N-glycosylation sites. Fvlac7 cDNA was heterologously overexpressed in an Escherichia coli system with an approximate expected molecular weight of 60 kDa.

• Animal cells and systems
• /
• 제3권3호
• /
• pp.295-301
• /
• 1999

The nucleotide sequence of a 447 base pair fragment in the mitochondrial cytochrome b gene and the complete sequence of the mitochondrial 12S ribosomal RNA gene, 938 bp, were analyzed to infer inter- and intraspecific genetic relationships of Hyla japonica and H. suweonensis from Korea and H, japonica from Japan. In the mitochondrial cytochrome b gene, genetic differentiation among H. japonica populations were 9.62% and 15.66% between H. japonica and H. suweonensis. Based on the Tamura-Nei distance, the level of sequence divergence ranged from 0.45% to 2.75% within Korean H. japonica, while 8.31%-8.87% between Korean and Japanese H. japonica and 11.51%-12.46% between H. japonica and H. suweonensis. In the neigh-bor-joining tree, Korean populations of H. japonica were clustered first at 2.22% and followed by Japanese H. japonica and H. suweonensis at 8.51% and 12.29%, respectively. In mitochondrial 12S rRNA gene, genetic differentiation between H. japonica and H. suweonensis nras 7.17% (68 bp) including 7 gaps. Based on Tamura-Nei distance, the level of sequence divergence ranged 3.53% between Korean and Japanese H. japonica and from 4.93% to 5.41% between H. japonica and H. suweonensis. Phenogram pattern of the 12S rRNA gene sequence corresponded with that of the mitochondrial cytochrome b gene.

• Journal of Microbiology and Biotechnology
• /
• 제3권4호
• /
• pp.224-231
• /
• 1993

The nucleotide sequence of the xylanase gene (xynY) from alkalophilic Bacillus sp. YC-335 was determined and analyzed. An open reading frame of 1, 062 base pairs for xynY gene was observed and encoded for a protein of 354 amino acids with a molecular weight of 38, 915. S1 nuclease mapping showed that the transcription initiation sites of the xynY gene were different in Bacillus sp. YC-335 and Escherichia coli HB101 (pYS55). S1 mapping also showed that -10 region of the xynY gene recognized by RNA polymerases of E. coli and Bacillus sp. YC-335 were TACAGT and TATGAT , respectively. A ribosome binding site sequence with the free energy of -17.0 Kcal/mol was observed 9 base pairs upstream from the unusual initiation codon, TTG. The proposed signal sequence consisted of 27 amino acids, 2 of which were basic amino acid residues and 21 were hydrophobic amino acid residues. When the amino acid sequences of xylanases were compared, Bacillus sp. YC-335 xylanase showed more than 50% homology with xylanases from B. pumilus, B. subtilis, and B. circulans.

• 생명과학회지
• /
• 제8권6호
• /
• pp.673-680
• /
• 1998

Nocardioides sp. J-326TK의 adenosine deaminase gene을 분리하기 위하여 genomic DNA를 제한효소로 무작위적으로 절단하여 pBluscript KS에 ligation시켰다. 또한 hu-man과 mouse, E. cali 등의 adenosine deaminase gene의 보존적인 부위를 primer로 합성을 하여 PCR reaction을 행하였다. Genomic DNA를 cloning시킨 pKSN60은 5kb정도의 DNA를 포함하고 있으며 sourthern hybridization 등의 여러 확인 실험을 통하여 adenosine deaminase gene을 포함하고 있다는 알았다. PCR product를 cloning시켜 형성된 recombinant plasmid를 PCR reaction의 primer로서 pTBN20를 sequencing을 행하였다. 그 결과를 다른 ade-nosine deaminase gene의 서열과 비교를 하였는데 미생물인 E. coli와는 nucleotide sequence는 99.5%, amino acid sequence는 98.9%의 homology를 나타내고 human과는 각각 59.5%, 46.8%의 homolosy를 나타내었다.

• Journal of Microbiology and Biotechnology
• /
• 제8권3호
• /
• pp.214-221
• /
• 1998

A Brevibacterium ammoniagenes gene coding for glucose/mannose-specific enzyme II ($EII^{Glc}$) of the phosphoenolpyruvate-dependent phosphotransferase system (PTS) was cloned by complementing an Escherichia coli mutation affecting a ptsG gene, and the complete DNA nucleotide sequence was determined. The cloned gene was identified to be a ptsG, which enables the E. coli transportment to use glucose more efficiently than mannose as the sole carbon source in an M9 minimal medium. The ptsG gene of B. ammoniagenes consists of an open reading frame of 1,983 nucleotides putatively encoding a polypeptide of 661 amino acid residues and a TAA stop codon. The deduced amino acid sequence of the B. ammoniagenes $EII^{Glc}$ shows, at $46\%$, the highest degree of sequence similarity with the Corynebacterium glutamicum EII specific for both glucose and mannose. In addition, the $EII^{Glc}$ shares approximately $30\%$ sequence similarities with sucrose-specific and ${\beta}$-glucoside-specific EIIs of the several bacteria belonging to the glucose-PTS class. The 161-amino-acid C-terminal sequence of $EII^{Glc}$ is also similar to that of E. coli enzyme $IIA^{Glc}$, specific for glucose ($EIIA^{Glc}$). The B. ammoniagenes $EII^{Glc}$ consists of three domains; a hydrophobic region (EIIC) and two hydrophilic regions (EIIA, EIIB). The arrangement of structural domains, IIBCA, of the $EII^{Glc}$ is identical to those of EIIs specific for sucrose or ${\beta}$-glucoside. While the domain IIA was removed from the B. ammoniagenes $EII^{Glc}$ the remaining domains IIBC were found to restore the glucose and mannose-utilizing capacity of E. coli mutant lacking $EII^{Glc}$ activity with $EIIA^{Glc}$ of the E. coli mutant. $EII^{Glc}$ contains a histidine residue and a cysteine residue which are putative phosphorylation sites for the protein.