Previously, as an effort to make an autonomously replicating expression vector in fish, an ARS (autonomously replicating sequence) was cloned from MAR (matrix attachment region) of Misgurnus mizolepis. The DNA fragment composed of 443 base pairs contains ARS core consensus sequences, topoisomerase II consensus sequences, and A or T box sequences which are homologous to the known consensus sequences originated from other organisms. The clond ARS, as other DNA replication origins, contains inverted repeat sequences and several potential hairpin loop structures. These consensus sequences and hairpin structures may serve as recognition signals for regulatory proteins of DNA replication initiation.
Sequential pattern mining is an important data mining task with broad applications. However, conventional methods may meet inherent difficulties in mining databases with long sequences and noise. They may generate a huge number of short and trivial patterns but fail to find interesting patterns shared by many sequences. In this paper, to overcome these problems, we propose the theme of approximate sequential pattern mining roughly defined as identifying patterns approximately shared by many sequences. The proposed method works in two steps: one is to cluster target sequences by their similarities and the other is to find consensus patterns that ire similar to the sequences in each cluster directly through multiple alignment. For this purpose, a novel structure called weighted sequence is presented to compress the alignment result, and the longest consensus pattern that represents each cluster is generated from its weighted sequence. Finally, the effectiveness of the proposed method is verified by a set of experiments.
DNA fragment assembly is a major concem in shot-gun DNA sequencing project. It is to reconstruct a consensus DNA sequence from a collection of random oritented fragments. We developed a computer program that is useful for DNA fragment assembly. Inputs to the program are DNA fragment sequences including IUB-IUPAC bases. The program produces the most probable reconstruction ot the original DNA sequence as a text format or a PostScript format. The program consists of four phases: the first phase quickly eliminates fragment pairs that can not possibly overlap. In the second phase, the quality of overlap between each pair is calculated to a score. In the third phase, overlap pairs are sorted by their scores and consistency of the overlaps is checked. The last phase determines consensus sequences and displays them. The performance of fragment assembly program was tested on a set of DNA fragment sequences which were generated from long DNA sequences of GenBank by a fragmentation program.
One clone(pANt32) carring tRNA/sup Arg/ gene was selected from Aspergillus total tRNA gene clones. The nucleotide sequences of this tRNA gene were determined by Maxam and Gilbert's chemical cleavage methods. The sequence of this tRNA gene is as follow; 5'GGCCGGCTGCCCAATTGGCAAGGCGTCTGACTACGAATCAGGAGAT TGCAGGTTCGAGCCCTGCGTGGGTCA3'. This sequence conicides with the characteristecs of other eukaryotic tRNA. Some consensus sequences (ACT-TA bow, TATTTT and T-cluster) are found in both 5'-end and 3'-end flanking regions.
Only one natural promoter that interacts with bacteriophage K11 RNA polymerase has so far been identified. To identify more, in the present study restriction fragments of the phage genome were individually assayed for transcription activity in vitro. The K11 genome was digested with two 4-bp-recognizing restriction enzymes, and the fragments cloned in pUC119 were assayed with purified K11 RNA polymerase. Eight K11 promoter-bearing fragments were isolated and sequenced. We report that the nine K11 promoter sequences (including the one previously identified) were highly homologous from -17 to +4, relative to the initiation site at +1. Interestingly, five had -10G and -8A, while the other four had -10A and -8C. The consensus sequences with the natural -10G/-8A and -10A/-8C, and their variants with -10G/-8C and -10A/-8A, showed nearly equal transcription activity, suggesting residues at -10 and -8 do not regulate promoter activity. Using hybridization methods, physical positions of the cloned promoter-bearing sequences were mapped on SalI-and KpnI-restriction maps of the K11 genome. The flanking sequences of six cloned K11 promoters were found to be orthologous with T7 or T3 genomic sequences.
We generated 16,993 expressed sequence tags (ESTs) from two libraries containing full-length cDNAs from the brain and liver of the Korean Jindo dog. An additional 365,909 ESTs from other dog breeds were identified from the NCBI dbEST database, and all ESTs were clustered into 28,514 consensus sequences using StackPack. We selected the 7,305 consensus sequences that could be assembled from at least five ESTs and estimated that 12,533 high-quality single nucleotide polymorphisms (SNPs) were present in 97,835 putative SNPs from the 7,305 consensus sequences. We identified 58 Jindo dog-specific SNPs in comparison to other breeds and predicted seven synonymous SNPs and ten non-synonymous SNPs. Using PolyPhen, a program that predicts changes in protein structure and potential effects on protein function caused by amino acid substitutions, three of the non-synonymous SNPs were predicted to result in changes in protein function for proteins expressed by three different genes (TUSC3, ITIH2, and NAT2).
Attempts using in vitro and in vivo selection procedures have been made to search for hammerhead ribozymes that have higher activities than the wild-type ribozyme and also to determine whether other sequences might be possible in the catalytic core of the hammerhead ribozyme. Active sequences selected in the past conformed broadly to the consensus core sequence except at A9, and no sequences were associated with higher activity than that of the hammerhead with the consensus core, an indication that the consensus sequence derived from viruses and virusoids is probably the optimal sequence [Vaish et al. (1997) Biochemistry 36, 6495-6501]. Recently, during construction of ribozyme expression vectors, we isolated a mutant hammerhead ribozyme, with an insertion of G between A9 and G10.1, that appeared to show significant activity [Kawasaki et al. (1996) Nucleic Acids Res. 24, 3010-3016; Kawasaki et al. (1998) Nature 393, 284-289]. We, therefore, characterized kinetic properties of the G-inserted mutant ribozymes in terms of the NUX rule. We demonstrate that the NUX rule is basically applicable to the G-inserted ribozymes and, more importantly, one type of G-inserted ribozyme was very active with $k_{cat}$, value of $6.4\;min^{-1}$ in 50 mM Tris-HCl (pH 8.0) and 10 mM $MgCl_2$ at $37^{\circ}C$.
Mixed primers based on the high sequence homology of selected regions of known connexins (Cxs) was used for PCR reaction. A full-length connexin cDNA of sweetfish (Plecoglossus altivelis) was cloned by rapid amplification of cDNA 5'and (5'RACE) and 3'RACE method. When compared to other known Cx sequences, homology of sweetfish Cx cDNA to Atlantic croaker, Mycropogonias undulatus Cx32.7, bovine, Bos taurus Cx44 and Atlantic croaker Cx32.2 were $63.8{\%},\;61.6{\%}\;and\;56.7{\%}$, respectively. This cDNA encoded 308 amino acids (35,028 dalton) and named as sweetfish Cx35. Hydropathicity analysis of predicted amino acid sequences indicated that sweetfish Cx35 have four major hydrophobic regions and four major hydrophilic regions, suggesting its topology is similar to that of known Cxs. The presence of a tfical Cx consensus sequences were identified in each of the extracellular loops (first loop and second loop).
Adozelesin and carzelesin are synthetic analogues of the extremely potent antitumor antibiotic CC-1065, which alkylates N3 of adenine in a consensus sequence $5^1$-(A/T)(A/T)$A^*$ ($A^*$ is the site of alkylation). We have investigated the DNA sequence selectivity of adozelesin and carzelesin by thermally ind ced DNA strand cleavage assay using radiolabeled restriction DNA fragments. An analysis of alkylation patterns shows that the consensus sequences for carzelesin and adozelesin have been found to be $5^1$-(A/T)(A/T)$A^*$ and $5^1$-(A/F)(G/C)(A/T)$A^*$. A new consensus sequence, $5^1$-(A/T)(A/T)$CA^*$, has been observed to display an additional alkylation site for adozelesin but not for carzelesin. These results indicate that the pattern of sequence selectivity induced by carzelesin is similar but not identical to those induced by adozelosin.
Accurate detection, tracking and analysis of human movement using robots and other visual surveillance systems is still a challenge. Efforts are on to make the system robust against constraints such as variation in shape, size, pose and occlusion. Traditional methods of detection used the sliding window approach which involved scanning of various sizes of windows across an image. This paper concentrates on employing a state-of-the-art, hierarchical graph based method for segmentation. It has two stages: part level segmentation for color-consistent segments and object level segmentation for category-consistent regions. The tracking phase is achieved by employing SIFT keypoint descriptor based technique in a combined matching and tracking scheme with validation phase. Localization of human region in each frame is performed by keypoints by casting votes for the center of the human detected region. As it is difficult to avoid incorrect keypoints, a consensus-based framework is used to detect voting behavior. The designed methodology is tested on the video sequences having 3 to 4 persons.
본 웹사이트에 게시된 이메일 주소가 전자우편 수집 프로그램이나
그 밖의 기술적 장치를 이용하여 무단으로 수집되는 것을 거부하며,
이를 위반시 정보통신망법에 의해 형사 처벌됨을 유념하시기 바랍니다.
[게시일 2004년 10월 1일]
이용약관
제 1 장 총칙
제 1 조 (목적)
이 이용약관은 KoreaScience 홈페이지(이하 “당 사이트”)에서 제공하는 인터넷 서비스(이하 '서비스')의 가입조건 및 이용에 관한 제반 사항과 기타 필요한 사항을 구체적으로 규정함을 목적으로 합니다.
제 2 조 (용어의 정의)
① "이용자"라 함은 당 사이트에 접속하여 이 약관에 따라 당 사이트가 제공하는 서비스를 받는 회원 및 비회원을
말합니다.
② "회원"이라 함은 서비스를 이용하기 위하여 당 사이트에 개인정보를 제공하여 아이디(ID)와 비밀번호를 부여
받은 자를 말합니다.
③ "회원 아이디(ID)"라 함은 회원의 식별 및 서비스 이용을 위하여 자신이 선정한 문자 및 숫자의 조합을
말합니다.
④ "비밀번호(패스워드)"라 함은 회원이 자신의 비밀보호를 위하여 선정한 문자 및 숫자의 조합을 말합니다.
제 3 조 (이용약관의 효력 및 변경)
① 이 약관은 당 사이트에 게시하거나 기타의 방법으로 회원에게 공지함으로써 효력이 발생합니다.
② 당 사이트는 이 약관을 개정할 경우에 적용일자 및 개정사유를 명시하여 현행 약관과 함께 당 사이트의
초기화면에 그 적용일자 7일 이전부터 적용일자 전일까지 공지합니다. 다만, 회원에게 불리하게 약관내용을
변경하는 경우에는 최소한 30일 이상의 사전 유예기간을 두고 공지합니다. 이 경우 당 사이트는 개정 전
내용과 개정 후 내용을 명확하게 비교하여 이용자가 알기 쉽도록 표시합니다.
제 4 조(약관 외 준칙)
① 이 약관은 당 사이트가 제공하는 서비스에 관한 이용안내와 함께 적용됩니다.
② 이 약관에 명시되지 아니한 사항은 관계법령의 규정이 적용됩니다.
제 2 장 이용계약의 체결
제 5 조 (이용계약의 성립 등)
① 이용계약은 이용고객이 당 사이트가 정한 약관에 「동의합니다」를 선택하고, 당 사이트가 정한
온라인신청양식을 작성하여 서비스 이용을 신청한 후, 당 사이트가 이를 승낙함으로써 성립합니다.
② 제1항의 승낙은 당 사이트가 제공하는 과학기술정보검색, 맞춤정보, 서지정보 등 다른 서비스의 이용승낙을
포함합니다.
제 6 조 (회원가입)
서비스를 이용하고자 하는 고객은 당 사이트에서 정한 회원가입양식에 개인정보를 기재하여 가입을 하여야 합니다.
제 7 조 (개인정보의 보호 및 사용)
당 사이트는 관계법령이 정하는 바에 따라 회원 등록정보를 포함한 회원의 개인정보를 보호하기 위해 노력합니다. 회원 개인정보의 보호 및 사용에 대해서는 관련법령 및 당 사이트의 개인정보 보호정책이 적용됩니다.
제 8 조 (이용 신청의 승낙과 제한)
① 당 사이트는 제6조의 규정에 의한 이용신청고객에 대하여 서비스 이용을 승낙합니다.
② 당 사이트는 아래사항에 해당하는 경우에 대해서 승낙하지 아니 합니다.
- 이용계약 신청서의 내용을 허위로 기재한 경우
- 기타 규정한 제반사항을 위반하며 신청하는 경우
제 9 조 (회원 ID 부여 및 변경 등)
① 당 사이트는 이용고객에 대하여 약관에 정하는 바에 따라 자신이 선정한 회원 ID를 부여합니다.
② 회원 ID는 원칙적으로 변경이 불가하며 부득이한 사유로 인하여 변경 하고자 하는 경우에는 해당 ID를
해지하고 재가입해야 합니다.
③ 기타 회원 개인정보 관리 및 변경 등에 관한 사항은 서비스별 안내에 정하는 바에 의합니다.
제 3 장 계약 당사자의 의무
제 10 조 (KISTI의 의무)
① 당 사이트는 이용고객이 희망한 서비스 제공 개시일에 특별한 사정이 없는 한 서비스를 이용할 수 있도록
하여야 합니다.
② 당 사이트는 개인정보 보호를 위해 보안시스템을 구축하며 개인정보 보호정책을 공시하고 준수합니다.
③ 당 사이트는 회원으로부터 제기되는 의견이나 불만이 정당하다고 객관적으로 인정될 경우에는 적절한 절차를
거쳐 즉시 처리하여야 합니다. 다만, 즉시 처리가 곤란한 경우는 회원에게 그 사유와 처리일정을 통보하여야
합니다.
제 11 조 (회원의 의무)
① 이용자는 회원가입 신청 또는 회원정보 변경 시 실명으로 모든 사항을 사실에 근거하여 작성하여야 하며,
허위 또는 타인의 정보를 등록할 경우 일체의 권리를 주장할 수 없습니다.
② 당 사이트가 관계법령 및 개인정보 보호정책에 의거하여 그 책임을 지는 경우를 제외하고 회원에게 부여된
ID의 비밀번호 관리소홀, 부정사용에 의하여 발생하는 모든 결과에 대한 책임은 회원에게 있습니다.
③ 회원은 당 사이트 및 제 3자의 지적 재산권을 침해해서는 안 됩니다.
제 4 장 서비스의 이용
제 12 조 (서비스 이용 시간)
① 서비스 이용은 당 사이트의 업무상 또는 기술상 특별한 지장이 없는 한 연중무휴, 1일 24시간 운영을
원칙으로 합니다. 단, 당 사이트는 시스템 정기점검, 증설 및 교체를 위해 당 사이트가 정한 날이나 시간에
서비스를 일시 중단할 수 있으며, 예정되어 있는 작업으로 인한 서비스 일시중단은 당 사이트 홈페이지를
통해 사전에 공지합니다.
② 당 사이트는 서비스를 특정범위로 분할하여 각 범위별로 이용가능시간을 별도로 지정할 수 있습니다. 다만
이 경우 그 내용을 공지합니다.
제 13 조 (홈페이지 저작권)
① NDSL에서 제공하는 모든 저작물의 저작권은 원저작자에게 있으며, KISTI는 복제/배포/전송권을 확보하고
있습니다.
② NDSL에서 제공하는 콘텐츠를 상업적 및 기타 영리목적으로 복제/배포/전송할 경우 사전에 KISTI의 허락을
받아야 합니다.
③ NDSL에서 제공하는 콘텐츠를 보도, 비평, 교육, 연구 등을 위하여 정당한 범위 안에서 공정한 관행에
합치되게 인용할 수 있습니다.
④ NDSL에서 제공하는 콘텐츠를 무단 복제, 전송, 배포 기타 저작권법에 위반되는 방법으로 이용할 경우
저작권법 제136조에 따라 5년 이하의 징역 또는 5천만 원 이하의 벌금에 처해질 수 있습니다.
제 14 조 (유료서비스)
① 당 사이트 및 협력기관이 정한 유료서비스(원문복사 등)는 별도로 정해진 바에 따르며, 변경사항은 시행 전에
당 사이트 홈페이지를 통하여 회원에게 공지합니다.
② 유료서비스를 이용하려는 회원은 정해진 요금체계에 따라 요금을 납부해야 합니다.
제 5 장 계약 해지 및 이용 제한
제 15 조 (계약 해지)
회원이 이용계약을 해지하고자 하는 때에는 [가입해지] 메뉴를 이용해 직접 해지해야 합니다.
제 16 조 (서비스 이용제한)
① 당 사이트는 회원이 서비스 이용내용에 있어서 본 약관 제 11조 내용을 위반하거나, 다음 각 호에 해당하는
경우 서비스 이용을 제한할 수 있습니다.
- 2년 이상 서비스를 이용한 적이 없는 경우
- 기타 정상적인 서비스 운영에 방해가 될 경우
② 상기 이용제한 규정에 따라 서비스를 이용하는 회원에게 서비스 이용에 대하여 별도 공지 없이 서비스 이용의
일시정지, 이용계약 해지 할 수 있습니다.
제 17 조 (전자우편주소 수집 금지)
회원은 전자우편주소 추출기 등을 이용하여 전자우편주소를 수집 또는 제3자에게 제공할 수 없습니다.
제 6 장 손해배상 및 기타사항
제 18 조 (손해배상)
당 사이트는 무료로 제공되는 서비스와 관련하여 회원에게 어떠한 손해가 발생하더라도 당 사이트가 고의 또는 과실로 인한 손해발생을 제외하고는 이에 대하여 책임을 부담하지 아니합니다.
제 19 조 (관할 법원)
서비스 이용으로 발생한 분쟁에 대해 소송이 제기되는 경우 민사 소송법상의 관할 법원에 제기합니다.
[부 칙]
1. (시행일) 이 약관은 2016년 9월 5일부터 적용되며, 종전 약관은 본 약관으로 대체되며, 개정된 약관의 적용일 이전 가입자도 개정된 약관의 적용을 받습니다.