• Journal of Microbiology and Biotechnology
• /
• v.31 no.9
• /
• pp.1210-1217
• /
• 2021

Two gram-negative, catalase-positive, strictly aerobic, and white colony-forming bacteria, strains H242^T and B156^T, were isolated from soil in South Korea. Cells of strain H242^T were oxidase-positive and non-motile short rods, while those of strain B156^T were oxidase-negative and long non-motile rods. Ubiquinone-8 was identified as the sole isoprenoid quinone in both strains. C_16:0, cyclo-C_17:0, andsummed feature 3 (C_16:1 ω7c and/or C_16:1 ω6c) and phosphatidylethanolamine, phosphatidylglycerol, and diphosphatidylglycerol were identified in both strains as the major cellular fatty acids and polar lipids, respectively. The DNA G+C contents of strains H242^T and B156^T were 69.4 mol% and 69.3 mol%, respectively. Phylogenetic analyses based on 16S rRNA and 92 concatenated core gene sequences revealed that strains H242^T and B156^T formed distinct phylogenic lineages from other Ramlibacter type strains. The DNA-DNA hybridization (DDH) value between strains H242^T and B156^T was 24.6%. Strains H242^T and B156^T were most closely related to Ramlibacter ginsenosidimutans BXN5-27^T and Ramlibacter monticola G-3-2^T with 98.4% and 98.6% 16S rRNA gene sequence similarities, respectively. Digital DDH values between strain H242^T and R. ginsenosidimutans and between strain B156^T and R. monticola were 23.5% and 26.1%, respectively. Phenotypic, chemotaxonomic, and molecular analyses indicated that strains H242^T and B156^T represent two novel species of the genus Ramlibacter, for which the names Ramlibacter terrae sp. nov. and Ramlibacter montanisoli sp. nov., respectively, are proposed. The type strains of R. terrae and R. montanisoli are H242^T (=KACC 21667^T=JCM 33922^T) and B156^T (=KACC 21665^T=JCM 33920^T), respectively.

• Journal of Microbiology and Biotechnology
• /
• v.34 no.7
• /
• pp.1475-1483
• /
• 2024

Three Gram-stain-positive, aerobic, rod-shaped, and non-motile bacteria, labelled as W11^T, SW19^T, and YR1^T, were isolated from soil, and performed their polyphasic taxonomic investigation. The phylogenetic and 16S rRNA gene sequence analysis showed that strains W11^T, SW19^T, and YR1^T belonged to the genera Agromyces, Rathayibacter, and Nocardioides, respectively. Strain W11^T was closely affiliated with Agromyces cavernae SYSU K20354^T (98.1%), strain SW19^T showed the closest affiliation with Rathayibacter rubneri ZW T2_19^T (97.0%), and strain YR1^T was most closely related to Nocardioides marmorisolisilvae KIS18-7^T (98.0%). The genome sizes of strains W11^T, SW19^T, and YR1^T were 4,181,720 bp, 4,740,677 bp, and 4,228,226 bp, respectively, with DNA G+C contents of 70.5%, 64.2%, and 69.7%, respectively. Average nucleotide identity and digital DNA-DNA hybridization values of W11^T, SW19^T, and YR1^T with their respective reference species were <79.6% and <23.6%, respectively. The predominant cellular fatty acids detected in strain W11^T were anteiso-C_15:0, iso-C_16:0, and anteiso-C_17:0. In strain SW19^T, they were summed feature 9 (C_16:0 10-methyl and/or iso-C_17:1ω 9c), anteiso-C_17:0, and anteiso-C_15:0. Strain YR1^T exhibited C_18:1ω 9c, C_18:0 10-methyl, TBSA, and anteiso-C_15:0 as its major cellular fatty acids. Overall, the polyphasic taxonomic comparisons indicated that strains W11^T, SW19^T, and YR1^T represent novel species within the genera Agromyces, Rathayibacter, and Nocardioides, respectively. Accordingly, we propose the names Agromyces silvae sp. nov., with the type strain W11^T (=KCTC 49818^T =NBRC 115999^T), Rathayibacter soli sp. nov., with the type strain SW19^T (=KCTC 49860^T =NBRC 116108^T), and Nocardioides terrisoli sp. nov., with the type strain YR1^T (=KCTC 49863^T =NBRC 116165^T).

• Journal of Microbiology and Biotechnology
• /
• v.17 no.10
• /
• pp.1655-1660
• /
• 2007

A metagenome is a unique resource to search for novel microbial enzymes from the unculturable microorganisms in soil. A forest soil metagenomic library using a fosmid and soil microbial DNA from Gwangneung forest, Korea, was constructed in Escherichia coli and screened to select lipolytic genes. A total of seven unique lipolytic clones were selected by screening of the 31,000-member forest soil metagenome library based on tributyrin hydrolysis. The ORFs for lipolytic activity were subcloned in a high copy number plasmid by screening the secondary shortgun libraries from the seven clones. Since the lipolytic enzymes were well secreted in E. coli into the culture broth, the lipolytic activity of the subclones was confirmed by the hydrolysis of p-nitrophenyl butyrate using culture supernatant. Deduced amino acid sequence analysis of the identified ORFs for lipolytic activity revealed that 4 genes encode hormone-sensitive lipase (HSL) in lipase family IV. Phylogenetic analysis indicated that 4 proteins were clustered with HSL in the database and other metagenomic HSLs. The other 2 genes and 1 gene encode non-heme peroxidase-like enzymes of lipase family V and a GDSL family esterase/lipase in family II, respectively. The gene for the GDSL enzyme is the first description of the enzyme from metagenomic screening.

• Research in Plant Disease
• /
• v.11 no.2
• /
• pp.128-134
• /
• 2005

This study was conducted to elucidate effect of environmental factors on the development of white rot. In order to identify the causal agents causing white rot of Allium crops, we compared DNA profiles of a representative isolate, Sclerotium cepivorum, introduced from foreign country with Korean isolates using UP-PCR. As a result, Sclerotium isolates forming round-shaped sclerotia were identified as Sclerotium cepivorum pertaining in UP-PCR b group and Sclerotium isolates farming anamorphic-shaped sclerotia presumed to be a novel species of Sclerotium based on DNA profiles of UP-PCR. There was a big difference in DNA band pattern between two species of Sclerotium isolated in Korea. Electron micrographs of scanning electron microscope and transmission electron microscope showed morphological differences in sclerotial surface structure and rind layers between two species of Sclerotium. There were more wrinkles and pore spaces on sclerotial surface of Sclerotium sp. forming anamorphic-shaped sclerotia than that of Sclerotium cepivorum forming round-shaped sclerotia. Both of two white rot pathogens grew well at the temperature range of $10-25^{\circ}C$ with optimal temperature of $20^{\circ}C$. Sclerotia of the two pathogens were well formed at $20^{\circ}C$ and well germinated at the temperature range of $20-24^{\circ}C$, Effect of pre-incubation of sclerotia on destruction of sclerotial dormancy of two pathogens was evaluated through storing sclerotia under different temperature condition. The sclerotia of the two pathogens showed an increased capacity to germinate on potato dextroise agar when the sclerotia were incubated for 7 days at $10^{\circ}C$ after pre-treatment at $35^{\circ}C$ for 7 days. At that time, germination rate of Sclerotium sp. and 5. cepivorum was $100\%\;and\;70\%$, respectively. Flooding period and treatment temperature had an effect on sclerotial survival rate of the two pathogens. As flooding period and treatment temperature increased, sclerotial germination rate of the two pathogens decreased. It was confirmed that soil humidity played an important role on development of white rot. It was the highest disease incidence of garlic white rot when garlic were sown at potted soils infested with the two pathogens and adjusted soil humidity to $15\%$ (field moisture capacity, about -300 mb). As soil humidity increase or decrease based on $15\%$ of soil humidity, disease incidence decreased move and more.

• Journal of Ecology and Environment
• /
• v.29 no.6
• /
• pp.551-558
• /
• 2006

Effects of Pb and $CO_2$ on soil microbial community associated with Pinus densiflora were investigated using community level physiological profiles (CLPP) and 16S rDNA PCR-denaturing gradient gel electrophoresis (DGGE) methods. Two-years pine trees were planted in Pb-contaminated soils and uncontaminated soils, and cultivated for 3 months in the growth chamber where $CO_2$ concentration was controlled at 380 or 760 ppmv. The structure of microbial community was analyzed in 6 kinds of soil samples (CA-0M : $CO_2$ 380 ppmv + Pb 0 mg/kg + initial, CB-0M : $CO_2$ 380 ppmv + Pb 500 mg/kg + initial, CA-3M : $CO_2$ 380 ppmv + Pb 0 mg/kg + after 3 months, CB-3M : $CO_2$ 380 ppmv + Pb 500 mglkg + after 3 months, EA-3M : $CO_2$ 760 ppmv + Pb 0 mg/kg + after 3 months, EB-3M : $CO_2$ 760 ppmv + Pb 500 mg/kg + after 3 months). After 3 months, the substrate utilization in the uncontaminated soil samples (CA-3M vs EA-3M) was not significantly influenced by $CO_2$ concentrations. However, the substrate utilization in the Pb-contaminated soil samples (CB-3M vs EB-3M) was enhanced by the elevated $CO_2$ concentrations. The results of principal component analysis based on substrate utilization activities showed that the structure of microbial community structure in each soil sample was grouped by Pb-contamination. The similarities of DGGE fingerprints were 56.3 % between the uncontaminated soil samples (CA-3M vs EA-3M), and 71.4% between the Pb-contaminated soil samples (CB-3M vs. EB-3M). The similarities between the soil samples under $CO_2$ 380 ppmv (CA-3M vs CB-3M) and $CO_2$, 760 ppmv (EA-3M vs EB-3M) were 53.3% and 35.8%, respectively. These results suggested that the structure of microbial community associated with Pinus densiflora were sensitively specialized by Pb-contamination rather than $CO_2$ concentration.

• Journal of Microbiology
• /
• v.39 no.1
• /
• pp.56-61
• /
• 2001

Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.

• Mycobiology
• /
• v.45 no.2
• /
• pp.64-72
• /
• 2017

In an ongoing survey of Korean indigenous fungi, three fungal strains belonging to the Sordariomycetes were isolated from soil samples. These strains were designated KNU16-001, KNU16-002, and KNU16-009, and identified as Ambrosiella grosmanniae, Acremonium sclerotigenum, and Trichocladium asperum, respectively, based on morphological characterization and phylogenetic analysis using internal transcribed spacer region sequences of ribosomal DNA. This is the first report of these species in Korea.

• Applied Biological Chemistry
• /
• v.48 no.3
• /
• pp.296-300
• /
• 2005

Among the root colonizing and plant growth promoting bacteria isolated from the bacterial wilt suppressive soil, five strains were detected to produce siderophores by CAS agar assay. The most effective isolate, TS3-7 strain induced significant suppression of bacterial wilt disease in tomato and pepper plants. Seed treatment followed by soil drench application with this strain resulted in over 80% reduction of bacterial wilt disease compared with the control. Significant disease suppression by TS3-7 strain was related to the production of siderophore. Besides iron competition, induction of resistance of the host plant with siderophore was suggested to be another mode of action that suppress bacterial wilt, based on the lack of direct antibiosis against pathogen in vitro. According to Bergey's Manual of Systemic Bacteriology and 16S rDNA sequence data, TS3-7 stain was identified as Pseudomonas sp. TS3-7.

• Proceedings of the PSK Conference
• /
• 2002.10a
• /
• pp.331.3-332
• /
• 2002

A novel penicillin G acylase (PGA)-producing bacterial strain was isolated from soil by using the Serratia marcescens overlay technique. The isolated strain was identified as Leclercia adecarboxylata based on the analyses of the biochemical characteristics (API 20E). the cellular fatty acid profile. and the 16S rDNA sequences. The gene encoding the PGA (pac gene) was cloned into the pHSG399 vector and the recombinant E. coliHB101 clones harboring the pac gene were isolated on agar plates containing phenylacetyl-L -leucine and penicillin G. (omitted)

• Mycobiology
• /
• v.43 no.1
• /
• pp.71-74
• /
• 2015

During a survey of fungal species in South Korea, a species of Volutella ciliata was isolated and described based on the analysis of the internal transcribed spacer region of its rDNA and its morphological characteristics. This is the first record of Volutella ciliata isolated from crop field soil in Korea.