• Title/Summary/Keyword: Plasmodiophora bassicae

Search Result 2, Processing Time 0.014 seconds

Development of an In Planta Molecular Marker for the Detection of Chinese Cabbage (Brassica campestris ssp. pekinensis) Club Root Pathogen Plasmodiophora brassicae

  • Kim, Hee-Jong;Lee, Youn-Su
    • Journal of Microbiology
    • /
    • v.39 no.1
    • /
    • pp.56-61
    • /
    • 2001
  • Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.

  • PDF

Race- and Isolate-specific Molecular Marker Development through Genome-Realignment Enables Detection of Korean Plasmodiophora brassicae Isolates, Causal agents of Clubroot Disease

  • Jeong, Ji -Yun;Robin, Arif Hasan Khan;Natarajan, Sathishkumar;Laila, Rawnak;Kim, Hoy-Taek;Park, Jong-In;Nou, Ill-Sup
    • The Plant Pathology Journal
    • /
    • v.34 no.6
    • /
    • pp.506-513
    • /
    • 2018
  • Clubroot is one of the most economically important diseases of the Brassicaceae family. Clubroot disease is caused by the obligate parasite Plasmodiophora brassicae, which is difficult to study because it is nonculturable in the laboratory and its races are genetically variable worldwide. In Korea, there are at least five races that belongs to four pathotype groups. A recent study conducted in Korea attempted to develop molecular markers based on ribosomal DNA polymorphism to detect P. brassicae isolates, but none of those markers was either race-specific or pathotype-specific. Our current study aimed to develop race- and isolate-specific markers by exploiting genomic sequence variations. A total of 119 markers were developed based on unique variation exists in genomic sequences of each of the races. Only 12 markers were able to detect P. brassicae strains of each isolate or race. Ycheon14 markers was specific to isolates of race 2, Yeoncheon and Hoengseong. Ycheon9 and Ycheon10 markers were specific to Yeoncheon isolate (race 2, pathotype 3), ZJ1-3, ZJ1-4 and ZJ1-5 markers were specific to Haenam2 (race 4) isolate, ZJ1-35, ZJ1-40, ZJ1-41 and ZJ1-49 markers were specific to Hoengseong isolate and ZJ1-56 and ZJ1-64 markers were specific to Pyeongchang isolate (race 4, pathotype 3). The PCR-based sequence characterized amplified region (SCAR) markers developed in this study are able to detect five Korean isolates of P. brassicae. These markers can be utilized in identifying four Korean P. brassicae isolates from different regions. Additional effort is required to develop race- and isolate-specific markers for the remaining Korean isolates.