Proceedings of the Korean Society of Plant Pathology Conference
/
1995.06b
/
pp.27-53
/
1995
In plant pathology there is an increasing necessity for improved cytological techniques as basis for the localization of cellular substances within the dynamic fine structure of the host-(plant)-pathogen-interaction. Low temperature (LT) preparation techniques (shock freezing, freeze substitution, LT embedding) are now successfully applied in plant pathology. They are regarded as important tools to stabilize the dynamic plant-pathogen-interaction as it exists under physiological conditions. - The main advantage of LT techniques versus conventional chemical fixation is seen in the maintenance of the hydration shell of molecules and macromolecular structures. This results in an improved fine structural preservation and in a superior retention of the antigenicity of proteins. - A well defined ultrastructure of small, fungal organisms and large biological samples such as plant material and as well as the plant-pathogen (fungus) infection sites are presented. The mesophyll tissue of Arabidopsis thaliana is characterized by homogeneously structured cytoplasm closely attached to the cell wall. From analyses of the compatible interaction between Erysiphe graminis f. sp. hordei on barley (Hordeum vulgare), various steps in the infection sequence can be identified. Infection sites of powdery mildew on primary leaves of barley are analysed with regard to the fine structural preservation of the haustoria. The presentation s focussed on the ultrastructure of the extrahaustorial matrix and the extrahaustorial membrane. - The integration of improved cellular preservation with a molecular analysis of the infected host cell is achieved by the application of secondary probing techniques, i.e. immunocytochemistry. Recent data on the characterization of freeze substituted powdery mildew and urst infected plant tissue by immunogold methodology are described with special emphasis on the localization of THRGP-like (threonine-hydrxyproline-rich glycoprotein) epitopes. Infection sites of powdery mildew on barley, stem rust as well as leaf rust (Puccinia recondita) on primary leaves of wheat were probed with a polyclonal antiserum to maize THRGP. Cross-reactivity with the anti-THRGP antiserum was observed over the extrahaustorial matrix of the both compatible and incompatible plant-pathogen interactions. The highly localized accumulation of THRGP-like epitopes at the extrahaustorial host-pathogen interface suggests the involvement of structural, interfacial proteins during the infection of monocotyledonous plants by obligate, biotrophic fungi.
Six strains of an obligate predatory bdellovibrio isolate that preys on Burkholderia glumae in rice paddy field water and rhizosphere soil, were identified and characterized. The numbers of Bdellovibrio cells varied from $3.2{\times}10^3$ to $9.2{\times}10^3$ plaque-forming unit/g after enrichment in cells of B. glumae. Prey range tests with six Bdellovibrio strains and 17 prey strains of rice-pathogenic, antibiosis-related, or nitrogen-fixing bacteria resulted in unique predation patterns in related prey cells. Strain BG282 had the widest prey range on 7 plant pathogenic bacteria among the 17 prey strains tested. However, no predation occurred with strains of Azospirillum brasilense, Paenibacillus polymyxa, Pseudomonas fluorescens, P. putida, and Serratia marcescens that are associated with antibiosis or nitrogen fixation in the rice ecosystem. Identification was confirmed by the presence of typical bdelloplast in the prey cells of B. glumae and by a PCR assay using B. bacteriovorus-specific primers. Furthermore, 16S rDNA sequencing of the six bdellovibrio strains showed a homology range of 97.2% to 99.2% to the type strain of B. bacteriovorus.
Clubroot disease is caused by the soil-born obligate plant pathogen Plasmodiophora brassicae. This pathogen can infect all cruciferous vegetables and oil crops, including Brassica rapa, B. oleracea, B. napus, and other Brassica species. Clubroot disease is now considered to be a major problem in Chinese cabbage production in China, Korea, and Japan. We collected several hundreds of P. brassicae infected galls from Korea, and isolated the single spore from the collection. For establishment of novel isolation, and mass-propagation methods for singe spore isolates of P. brassicae pathogen, we developed new filtration method using both cellulose nitrate filter and syringe filter. Accurate detection of P. brassicae pathogen in the field was done by using real-time PCR in the potential infested soil. When we tested the different pathogenicity on commercial Chinese cabbage varieties, P. brassicae from collected galls showed various morphological patterns about clubroot symptom on roots. To date, 8 CR loci have been identified in the B. rapa genome using the quantitative trait loci (QTL) mapping approach, with different resistant sources and isolates. We are trying to develop the molecular marker systems for detect all 8 CR resistant genes. Especially for the study on the interaction between pathogens and CR loci which are not well understood until now, genome wide association studies are doing using the sequenced inbred lines of Chinese cabbage to detect the novel CR genes.
Peronospora is the largest genus of the order Peronosporales (Oomycota) and contains more than 550 accepted species, which causes downy mildew on many economically important crops. During a survey of downy mildew flora in Korea, a previously unreported species of Peronospora has been found on Corydalis ambigua. Based on molecular phylogenetic and morphological analyses, the causal agent was identified as Peronospora bulbocapni. This is the first report of Peronospora bulbocapni occurring on Corydalis ambigua in Korea.
Nontypeable H. influenzae (NTHi), a Gram-negative obligate human pathogen, causes pneumonia, chronic bronchitis, and otitis media, and the respiratory epithelium is the first line of defense that copes with the pathogen. In an effort to identify transcriptional responses of human respiratory epithelial cells to infection with NTHi, we examined its differential gene expression using high density cDNA microarrays. BEAS-2B human bronchial epithelial cells were exposed to NTHi for 3 hand 24 h, and the alteration of mRNA expression was analyzed using microarrays consisting of 8,170 human cDNA clones. The results indicated that approximately 2.6% of the genes present on the microarrays increased in expression over 2-fold and 3.8% of the genes decreased during the 24-h infection period. Upregulated genes included cytokines (granulocyte-macrophage colony stimulating factor 2, granulocyte chemotactic protein 2, IL-6, IL-10, IL-8), transcription factors (Kruppel-like factor 7, CCAAT/enhancer binding protein $\beta$, E2F-1, NF-$\kappa$B, cell surface molecules (CD74, ICAM-1, ICAM-2, HLA class I), as well as those involved in signal transduction and cellular transport. Selected genes were further confirmed by reverse-transcription-PCR. These data expand our knowledge of host cellular responses during NTHi infection and should provide a molecular basis for the study of host-NTHi interaction.
Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.
The genus Pseudoperonospora, an obligate biotrophic group of Oomycota, causes the most destructive foliar downy mildew disease on many economically important crops and wild plants. A previously unreported disease by Pseudoperonospora was found on oriental pickling melon (Cucumis melo var. conomon) in Korea, which is a minor crop cultivated in the temperate climate zone of East Asia, including China, Korea, and Japan. Based on molecular phylogenetic and morphological analyses, the causal agent was identified as Pseudoperonospora cubensis, and its pathogenicity has been proven. Importantly, two phylogenetic clades of P. cubensis, harboring probably two distinct species, were detected within the same plots, suggesting simultaneous coexistence of the two clades. This is the first report of P. cubensis causing downy mildew on oriental pickling melon in Korea, and the confirmation of presence of two phylogenetic clades of this pathogen in Korea. Given the high incidence of P. cubensis and high susceptibility of oriental pickling melon to this disease, phytosanitary measures, including rapid diagnosis and effective control management, are urgently required.
Choi, Jin Su;Yang, Seul Gi;Song, Jeong Young;Kim, Hong Gi
Research in Plant Disease
/
v.20
no.1
/
pp.21-24
/
2014
Clubroot caused by the obligate biotrophic protist Plasmodiophora brassicae Woronin is one of the most damaging diseases of Brassicaceae family. In this study, we developed species-specific primer sets for rapid and accurate detection of P. brassicae. The primer sets developed amplified a specific fragment only from P. brassicae DNA while they did not amplify a band from 10 other soilborne pathogens or from Kimchi cabbage. In sensitivity test, the species-specific primer set ITS1-1/ITS1-2 could work for approximately 10 spores/ml of genomic DNA showing more sensitivity and accuracy than previous methods. With quantitative real-time PCR test, the primer set detected less spores of P. brassicae than before, confirming that the species-specific primer set could be useful for rapid and accurate detection of P. brassicae.
Virginia creeper (or five-leaved ivy; Parthenocissus quinquefolia) is one of the most popular and widely grown climbers worldwide. In September 2021, Virginia creeper leaves with typical rust symptom were found in an arboretum in Korea, with severe damage. Globally, there is no record of a rust disease on Virginia creeper. Using morphological investigation and molecular phylogenetic inferences, the rust agent was identified as Neophysopella vitis, which is a rust pathogen of other Parthenocissus spp. including Boston ivy (P. tricuspidata). Given that the two ivy plants, Virginia creeper and Boston ivy, have common habitats, especially on buildings and walls, throughout Korea, and that N. vitis is a ubiquitous rust species affecting Boston ivy in Korea, it is speculated that the host range of N. vitis may recently have expanded from Boston ivy to Virginia creeper. The present study reports a globally new rust disease on Virginia creeper, which could be a major threat to the ornamental creeper.
F. nucleatum is a gram-negative obligate anaerobe which is the principal and most frequent cause of gingival inflammation and is the predominant pathogen isolated in subsequent periodontal breakdown. It is also one of the most numerous bacteria found in subgingival plaque samples from healthy sites; its numbers are about 10-fold greater in plaque from periodontally diseased sites. The purpose of this study is to examine the effects of outer membrane(OM), outer membrane vesicle(OMV), and lipopolysaccharide(LPS) from F. nucleatum ATCC 25586 strain on the growth of human gingival fibroblasts and HOS 941 cells, and on the $TNF-{\alpha}$ production / $TNF-{\alpha}$ mRNA expression of mouse splenocytes. For the examination of cytotoxic effects, $TNF-{\alpha}$ production and $TNF-{\alpha}$ mRNA expression, the MTT assay, the ELISA and the RT-PCR were performed, respectively. All extracts of F. nucleatum tested were cytotoxic to both of human gingival fibroblasts and HOS 941 cells, and the significant difference of cytotoxic activity among the extracts was not observed. In the effects of these extracts on the $TNF-{\alpha}$ production / $TNF-{\alpha}$ mRNA expression of mouse splenocytes, all extracts of F. nucleatum tested also stimulated the $TNF-{\alpha}$ production / $TNF-{\alpha}$ mRNA expression, but the effects of the OM extracts on the $TNF-{\alpha}$ production / $TNF-{\alpha}$ mRNA expression were higher than those of the OMV and the LPS extracts. The pattern of the $TNF-{\alpha}$ mRNA expression was similar to that of the $TNF-{\alpha}$ production. These results indicate that F. nucleatum seems to contribute to the pathogenesis of periodontal diseases at least by its cytotoxicity, directly and its $TNF-{\alpha}$ production, indirectly.
본 웹사이트에 게시된 이메일 주소가 전자우편 수집 프로그램이나
그 밖의 기술적 장치를 이용하여 무단으로 수집되는 것을 거부하며,
이를 위반시 정보통신망법에 의해 형사 처벌됨을 유념하시기 바랍니다.
[게시일 2004년 10월 1일]
이용약관
제 1 장 총칙
제 1 조 (목적)
이 이용약관은 KoreaScience 홈페이지(이하 “당 사이트”)에서 제공하는 인터넷 서비스(이하 '서비스')의 가입조건 및 이용에 관한 제반 사항과 기타 필요한 사항을 구체적으로 규정함을 목적으로 합니다.
제 2 조 (용어의 정의)
① "이용자"라 함은 당 사이트에 접속하여 이 약관에 따라 당 사이트가 제공하는 서비스를 받는 회원 및 비회원을
말합니다.
② "회원"이라 함은 서비스를 이용하기 위하여 당 사이트에 개인정보를 제공하여 아이디(ID)와 비밀번호를 부여
받은 자를 말합니다.
③ "회원 아이디(ID)"라 함은 회원의 식별 및 서비스 이용을 위하여 자신이 선정한 문자 및 숫자의 조합을
말합니다.
④ "비밀번호(패스워드)"라 함은 회원이 자신의 비밀보호를 위하여 선정한 문자 및 숫자의 조합을 말합니다.
제 3 조 (이용약관의 효력 및 변경)
① 이 약관은 당 사이트에 게시하거나 기타의 방법으로 회원에게 공지함으로써 효력이 발생합니다.
② 당 사이트는 이 약관을 개정할 경우에 적용일자 및 개정사유를 명시하여 현행 약관과 함께 당 사이트의
초기화면에 그 적용일자 7일 이전부터 적용일자 전일까지 공지합니다. 다만, 회원에게 불리하게 약관내용을
변경하는 경우에는 최소한 30일 이상의 사전 유예기간을 두고 공지합니다. 이 경우 당 사이트는 개정 전
내용과 개정 후 내용을 명확하게 비교하여 이용자가 알기 쉽도록 표시합니다.
제 4 조(약관 외 준칙)
① 이 약관은 당 사이트가 제공하는 서비스에 관한 이용안내와 함께 적용됩니다.
② 이 약관에 명시되지 아니한 사항은 관계법령의 규정이 적용됩니다.
제 2 장 이용계약의 체결
제 5 조 (이용계약의 성립 등)
① 이용계약은 이용고객이 당 사이트가 정한 약관에 「동의합니다」를 선택하고, 당 사이트가 정한
온라인신청양식을 작성하여 서비스 이용을 신청한 후, 당 사이트가 이를 승낙함으로써 성립합니다.
② 제1항의 승낙은 당 사이트가 제공하는 과학기술정보검색, 맞춤정보, 서지정보 등 다른 서비스의 이용승낙을
포함합니다.
제 6 조 (회원가입)
서비스를 이용하고자 하는 고객은 당 사이트에서 정한 회원가입양식에 개인정보를 기재하여 가입을 하여야 합니다.
제 7 조 (개인정보의 보호 및 사용)
당 사이트는 관계법령이 정하는 바에 따라 회원 등록정보를 포함한 회원의 개인정보를 보호하기 위해 노력합니다. 회원 개인정보의 보호 및 사용에 대해서는 관련법령 및 당 사이트의 개인정보 보호정책이 적용됩니다.
제 8 조 (이용 신청의 승낙과 제한)
① 당 사이트는 제6조의 규정에 의한 이용신청고객에 대하여 서비스 이용을 승낙합니다.
② 당 사이트는 아래사항에 해당하는 경우에 대해서 승낙하지 아니 합니다.
- 이용계약 신청서의 내용을 허위로 기재한 경우
- 기타 규정한 제반사항을 위반하며 신청하는 경우
제 9 조 (회원 ID 부여 및 변경 등)
① 당 사이트는 이용고객에 대하여 약관에 정하는 바에 따라 자신이 선정한 회원 ID를 부여합니다.
② 회원 ID는 원칙적으로 변경이 불가하며 부득이한 사유로 인하여 변경 하고자 하는 경우에는 해당 ID를
해지하고 재가입해야 합니다.
③ 기타 회원 개인정보 관리 및 변경 등에 관한 사항은 서비스별 안내에 정하는 바에 의합니다.
제 3 장 계약 당사자의 의무
제 10 조 (KISTI의 의무)
① 당 사이트는 이용고객이 희망한 서비스 제공 개시일에 특별한 사정이 없는 한 서비스를 이용할 수 있도록
하여야 합니다.
② 당 사이트는 개인정보 보호를 위해 보안시스템을 구축하며 개인정보 보호정책을 공시하고 준수합니다.
③ 당 사이트는 회원으로부터 제기되는 의견이나 불만이 정당하다고 객관적으로 인정될 경우에는 적절한 절차를
거쳐 즉시 처리하여야 합니다. 다만, 즉시 처리가 곤란한 경우는 회원에게 그 사유와 처리일정을 통보하여야
합니다.
제 11 조 (회원의 의무)
① 이용자는 회원가입 신청 또는 회원정보 변경 시 실명으로 모든 사항을 사실에 근거하여 작성하여야 하며,
허위 또는 타인의 정보를 등록할 경우 일체의 권리를 주장할 수 없습니다.
② 당 사이트가 관계법령 및 개인정보 보호정책에 의거하여 그 책임을 지는 경우를 제외하고 회원에게 부여된
ID의 비밀번호 관리소홀, 부정사용에 의하여 발생하는 모든 결과에 대한 책임은 회원에게 있습니다.
③ 회원은 당 사이트 및 제 3자의 지적 재산권을 침해해서는 안 됩니다.
제 4 장 서비스의 이용
제 12 조 (서비스 이용 시간)
① 서비스 이용은 당 사이트의 업무상 또는 기술상 특별한 지장이 없는 한 연중무휴, 1일 24시간 운영을
원칙으로 합니다. 단, 당 사이트는 시스템 정기점검, 증설 및 교체를 위해 당 사이트가 정한 날이나 시간에
서비스를 일시 중단할 수 있으며, 예정되어 있는 작업으로 인한 서비스 일시중단은 당 사이트 홈페이지를
통해 사전에 공지합니다.
② 당 사이트는 서비스를 특정범위로 분할하여 각 범위별로 이용가능시간을 별도로 지정할 수 있습니다. 다만
이 경우 그 내용을 공지합니다.
제 13 조 (홈페이지 저작권)
① NDSL에서 제공하는 모든 저작물의 저작권은 원저작자에게 있으며, KISTI는 복제/배포/전송권을 확보하고
있습니다.
② NDSL에서 제공하는 콘텐츠를 상업적 및 기타 영리목적으로 복제/배포/전송할 경우 사전에 KISTI의 허락을
받아야 합니다.
③ NDSL에서 제공하는 콘텐츠를 보도, 비평, 교육, 연구 등을 위하여 정당한 범위 안에서 공정한 관행에
합치되게 인용할 수 있습니다.
④ NDSL에서 제공하는 콘텐츠를 무단 복제, 전송, 배포 기타 저작권법에 위반되는 방법으로 이용할 경우
저작권법 제136조에 따라 5년 이하의 징역 또는 5천만 원 이하의 벌금에 처해질 수 있습니다.
제 14 조 (유료서비스)
① 당 사이트 및 협력기관이 정한 유료서비스(원문복사 등)는 별도로 정해진 바에 따르며, 변경사항은 시행 전에
당 사이트 홈페이지를 통하여 회원에게 공지합니다.
② 유료서비스를 이용하려는 회원은 정해진 요금체계에 따라 요금을 납부해야 합니다.
제 5 장 계약 해지 및 이용 제한
제 15 조 (계약 해지)
회원이 이용계약을 해지하고자 하는 때에는 [가입해지] 메뉴를 이용해 직접 해지해야 합니다.
제 16 조 (서비스 이용제한)
① 당 사이트는 회원이 서비스 이용내용에 있어서 본 약관 제 11조 내용을 위반하거나, 다음 각 호에 해당하는
경우 서비스 이용을 제한할 수 있습니다.
- 2년 이상 서비스를 이용한 적이 없는 경우
- 기타 정상적인 서비스 운영에 방해가 될 경우
② 상기 이용제한 규정에 따라 서비스를 이용하는 회원에게 서비스 이용에 대하여 별도 공지 없이 서비스 이용의
일시정지, 이용계약 해지 할 수 있습니다.
제 17 조 (전자우편주소 수집 금지)
회원은 전자우편주소 추출기 등을 이용하여 전자우편주소를 수집 또는 제3자에게 제공할 수 없습니다.
제 6 장 손해배상 및 기타사항
제 18 조 (손해배상)
당 사이트는 무료로 제공되는 서비스와 관련하여 회원에게 어떠한 손해가 발생하더라도 당 사이트가 고의 또는 과실로 인한 손해발생을 제외하고는 이에 대하여 책임을 부담하지 아니합니다.
제 19 조 (관할 법원)
서비스 이용으로 발생한 분쟁에 대해 소송이 제기되는 경우 민사 소송법상의 관할 법원에 제기합니다.
[부 칙]
1. (시행일) 이 약관은 2016년 9월 5일부터 적용되며, 종전 약관은 본 약관으로 대체되며, 개정된 약관의 적용일 이전 가입자도 개정된 약관의 적용을 받습니다.