• Proceedings of the Korean Society of Plant Pathology Conference
• /
• 1995.06b
• /
• pp.27-53
• /
• 1995

In plant pathology there is an increasing necessity for improved cytological techniques as basis for the localization of cellular substances within the dynamic fine structure of the host-(plant)-pathogen-interaction. Low temperature (LT) preparation techniques (shock freezing, freeze substitution, LT embedding) are now successfully applied in plant pathology. They are regarded as important tools to stabilize the dynamic plant-pathogen-interaction as it exists under physiological conditions. - The main advantage of LT techniques versus conventional chemical fixation is seen in the maintenance of the hydration shell of molecules and macromolecular structures. This results in an improved fine structural preservation and in a superior retention of the antigenicity of proteins. - A well defined ultrastructure of small, fungal organisms and large biological samples such as plant material and as well as the plant-pathogen (fungus) infection sites are presented. The mesophyll tissue of Arabidopsis thaliana is characterized by homogeneously structured cytoplasm closely attached to the cell wall. From analyses of the compatible interaction between Erysiphe graminis f. sp. hordei on barley (Hordeum vulgare), various steps in the infection sequence can be identified. Infection sites of powdery mildew on primary leaves of barley are analysed with regard to the fine structural preservation of the haustoria. The presentation s focussed on the ultrastructure of the extrahaustorial matrix and the extrahaustorial membrane. - The integration of improved cellular preservation with a molecular analysis of the infected host cell is achieved by the application of secondary probing techniques, i.e. immunocytochemistry. Recent data on the characterization of freeze substituted powdery mildew and urst infected plant tissue by immunogold methodology are described with special emphasis on the localization of THRGP-like (threonine-hydrxyproline-rich glycoprotein) epitopes. Infection sites of powdery mildew on barley, stem rust as well as leaf rust (Puccinia recondita) on primary leaves of wheat were probed with a polyclonal antiserum to maize THRGP. Cross-reactivity with the anti-THRGP antiserum was observed over the extrahaustorial matrix of the both compatible and incompatible plant-pathogen interactions. The highly localized accumulation of THRGP-like epitopes at the extrahaustorial host-pathogen interface suggests the involvement of structural, interfacial proteins during the infection of monocotyledonous plants by obligate, biotrophic fungi.

• Journal of Microbiology and Biotechnology
• /
• v.14 no.1
• /
• pp.48-55
• /
• 2004

Six strains of an obligate predatory bdellovibrio isolate that preys on Burkholderia glumae in rice paddy field water and rhizosphere soil, were identified and characterized. The numbers of Bdellovibrio cells varied from $3.2{\times}10^3$ to $9.2{\times}10^3$ plaque-forming unit/g after enrichment in cells of B. glumae. Prey range tests with six Bdellovibrio strains and 17 prey strains of rice-pathogenic, antibiosis-related, or nitrogen-fixing bacteria resulted in unique predation patterns in related prey cells. Strain BG282 had the widest prey range on 7 plant pathogenic bacteria among the 17 prey strains tested. However, no predation occurred with strains of Azospirillum brasilense, Paenibacillus polymyxa, Pseudomonas fluorescens, P. putida, and Serratia marcescens that are associated with antibiosis or nitrogen fixation in the rice ecosystem. Identification was confirmed by the presence of typical bdelloplast in the prey cells of B. glumae and by a PCR assay using B. bacteriovorus-specific primers. Furthermore, 16S rDNA sequencing of the six bdellovibrio strains showed a homology range of 97.2% to 99.2% to the type strain of B. bacteriovorus.

• 한국균학회소식:학술대회논문집
• /
• 2015.05a
• /
• pp.29-29
• /
• 2015

Clubroot disease is caused by the soil-born obligate plant pathogen Plasmodiophora brassicae. This pathogen can infect all cruciferous vegetables and oil crops, including Brassica rapa, B. oleracea, B. napus, and other Brassica species. Clubroot disease is now considered to be a major problem in Chinese cabbage production in China, Korea, and Japan. We collected several hundreds of P. brassicae infected galls from Korea, and isolated the single spore from the collection. For establishment of novel isolation, and mass-propagation methods for singe spore isolates of P. brassicae pathogen, we developed new filtration method using both cellulose nitrate filter and syringe filter. Accurate detection of P. brassicae pathogen in the field was done by using real-time PCR in the potential infested soil. When we tested the different pathogenicity on commercial Chinese cabbage varieties, P. brassicae from collected galls showed various morphological patterns about clubroot symptom on roots. To date, 8 CR loci have been identified in the B. rapa genome using the quantitative trait loci (QTL) mapping approach, with different resistant sources and isolates. We are trying to develop the molecular marker systems for detect all 8 CR resistant genes. Especially for the study on the interaction between pathogens and CR loci which are not well understood until now, genome wide association studies are doing using the sequenced inbred lines of Chinese cabbage to detect the novel CR genes.

• The Korean Journal of Mycology
• /
• v.46 no.4
• /
• pp.505-510
• /
• 2018

Peronospora is the largest genus of the order Peronosporales (Oomycota) and contains more than 550 accepted species, which causes downy mildew on many economically important crops. During a survey of downy mildew flora in Korea, a previously unreported species of Peronospora has been found on Corydalis ambigua. Based on molecular phylogenetic and morphological analyses, the causal agent was identified as Peronospora bulbocapni. This is the first report of Peronospora bulbocapni occurring on Corydalis ambigua in Korea.

• Journal of Microbiology and Biotechnology
• /
• v.14 no.4
• /
• pp.836-843
• /
• 2004

Nontypeable H. influenzae (NTHi), a Gram-negative obligate human pathogen, causes pneumonia, chronic bronchitis, and otitis media, and the respiratory epithelium is the first line of defense that copes with the pathogen. In an effort to identify transcriptional responses of human respiratory epithelial cells to infection with NTHi, we examined its differential gene expression using high density cDNA microarrays. BEAS-2B human bronchial epithelial cells were exposed to NTHi for 3 hand 24 h, and the alteration of mRNA expression was analyzed using microarrays consisting of 8,170 human cDNA clones. The results indicated that approximately 2.6% of the genes present on the microarrays increased in expression over 2-fold and 3.8% of the genes decreased during the 24-h infection period. Upregulated genes included cytokines (granulocyte-macrophage colony stimulating factor 2, granulocyte chemotactic protein 2, IL-6, IL-10, IL-8), transcription factors (Kruppel-like factor 7, CCAAT/enhancer binding protein $\beta$, E2F-1, NF-$\kappa$B, cell surface molecules (CD74, ICAM-1, ICAM-2, HLA class I), as well as those involved in signal transduction and cellular transport. Selected genes were further confirmed by reverse-transcription-PCR. These data expand our knowledge of host cellular responses during NTHi infection and should provide a molecular basis for the study of host-NTHi interaction.

• Journal of Microbiology
• /
• v.39 no.1
• /
• pp.56-61
• /
• 2001

Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.

• Mycobiology
• /
• v.49 no.2
• /
• pp.188-195
• /
• 2021

The genus Pseudoperonospora, an obligate biotrophic group of Oomycota, causes the most destructive foliar downy mildew disease on many economically important crops and wild plants. A previously unreported disease by Pseudoperonospora was found on oriental pickling melon (Cucumis melo var. conomon) in Korea, which is a minor crop cultivated in the temperate climate zone of East Asia, including China, Korea, and Japan. Based on molecular phylogenetic and morphological analyses, the causal agent was identified as Pseudoperonospora cubensis, and its pathogenicity has been proven. Importantly, two phylogenetic clades of P. cubensis, harboring probably two distinct species, were detected within the same plots, suggesting simultaneous coexistence of the two clades. This is the first report of P. cubensis causing downy mildew on oriental pickling melon in Korea, and the confirmation of presence of two phylogenetic clades of this pathogen in Korea. Given the high incidence of P. cubensis and high susceptibility of oriental pickling melon to this disease, phytosanitary measures, including rapid diagnosis and effective control management, are urgently required.

• Research in Plant Disease
• /
• v.20 no.1
• /
• pp.21-24
• /
• 2014

Clubroot caused by the obligate biotrophic protist Plasmodiophora brassicae Woronin is one of the most damaging diseases of Brassicaceae family. In this study, we developed species-specific primer sets for rapid and accurate detection of P. brassicae. The primer sets developed amplified a specific fragment only from P. brassicae DNA while they did not amplify a band from 10 other soilborne pathogens or from Kimchi cabbage. In sensitivity test, the species-specific primer set ITS1-1/ITS1-2 could work for approximately 10 spores/ml of genomic DNA showing more sensitivity and accuracy than previous methods. With quantitative real-time PCR test, the primer set detected less spores of P. brassicae than before, confirming that the species-specific primer set could be useful for rapid and accurate detection of P. brassicae.

• Mycobiology
• /
• v.50 no.3
• /
• pp.166-171
• /
• 2022

Virginia creeper (or five-leaved ivy; Parthenocissus quinquefolia) is one of the most popular and widely grown climbers worldwide. In September 2021, Virginia creeper leaves with typical rust symptom were found in an arboretum in Korea, with severe damage. Globally, there is no record of a rust disease on Virginia creeper. Using morphological investigation and molecular phylogenetic inferences, the rust agent was identified as Neophysopella vitis, which is a rust pathogen of other Parthenocissus spp. including Boston ivy (P. tricuspidata). Given that the two ivy plants, Virginia creeper and Boston ivy, have common habitats, especially on buildings and walls, throughout Korea, and that N. vitis is a ubiquitous rust species affecting Boston ivy in Korea, it is speculated that the host range of N. vitis may recently have expanded from Boston ivy to Virginia creeper. The present study reports a globally new rust disease on Virginia creeper, which could be a major threat to the ornamental creeper.

• Journal of Oral Medicine and Pain
• /
• v.24 no.4
• /
• pp.361-374
• /
• 1999

F. nucleatum is a gram-negative obligate anaerobe which is the principal and most frequent cause of gingival inflammation and is the predominant pathogen isolated in subsequent periodontal breakdown. It is also one of the most numerous bacteria found in subgingival plaque samples from healthy sites; its numbers are about 10-fold greater in plaque from periodontally diseased sites. The purpose of this study is to examine the effects of outer membrane(OM), outer membrane vesicle(OMV), and lipopolysaccharide(LPS) from F. nucleatum ATCC 25586 strain on the growth of human gingival fibroblasts and HOS 941 cells, and on the $TNF-{\alpha}$ production / $TNF-{\alpha}$ mRNA expression of mouse splenocytes. For the examination of cytotoxic effects, $TNF-{\alpha}$ production and $TNF-{\alpha}$ mRNA expression, the MTT assay, the ELISA and the RT-PCR were performed, respectively. All extracts of F. nucleatum tested were cytotoxic to both of human gingival fibroblasts and HOS 941 cells, and the significant difference of cytotoxic activity among the extracts was not observed. In the effects of these extracts on the $TNF-{\alpha}$ production / $TNF-{\alpha}$ mRNA expression of mouse splenocytes, all extracts of F. nucleatum tested also stimulated the $TNF-{\alpha}$ production / $TNF-{\alpha}$ mRNA expression, but the effects of the OM extracts on the $TNF-{\alpha}$ production / $TNF-{\alpha}$ mRNA expression were higher than those of the OMV and the LPS extracts. The pattern of the $TNF-{\alpha}$ mRNA expression was similar to that of the $TNF-{\alpha}$ production. These results indicate that F. nucleatum seems to contribute to the pathogenesis of periodontal diseases at least by its cytotoxicity, directly and its $TNF-{\alpha}$ production, indirectly.