• Biotechnology and Bioprocess Engineering:BBE
• /
• v.3 no.1
• /
• pp.1-5
• /
• 1998

One cervical cancer cell line, C9, carrying human papillomavirus type 18 (HPV18) genes that is one of the major etiologic concoviruses for cervical cancer was characterized. This cell line was further characterized for its capacity related to the epithelial cell proliferation, stratification and differentiation in reconstituted artificial epithelial tissue. The in vitro construction of three dimensional artificial cervical opithelial tissue has been engineered using C9 epithelial cancer cells, human foreskin fibroblasts and a matrix made of type I collagen by organotypic culture of epithelial cells. The morphology of paraffin embedded artificial tissue was examined by histochemical staining. The artificial epithelial tissues were well developed having multilayer. However, the tissue morphology was similar to the cervical tissus having displasia induced by HPV infection. The characteristics of the artificial tissues were examined by determinining the expression of specific marker proteins. In the C9 derived artificial tissues, the expression of EGF receptor, as epithelial proliferation marker proteins for stratum basale was observed up to the stratum spinosum. Another epithelial proliferation marker for stratum spinosum, cytokerations 5/6/18, were observed well over the stratum spinosum. For the differentiation markers, the expression of involucrin and filaggrin were observed while the terminal differentiation marker, cytokeratins 10/13 was not detected at all. Therefore the reconstituted artificial epithelial tissues expressed the same types of differentiation marker proteins that are expressed in normal human cervical epithelial tissues but lacked the final differentiation capacity representing characteristics of C9 cell line as a cancer tissue devived cell line. Expression of HPV18 E6 oncoprotein was also observed in this artifical cervical opithelial tissue though the intensity of the staining was weak. Thus this artificial epithelial tissue could be used as a useful model system to examine the relationship between HPV-induced cervical oncogenesis and epithelial cell differentiation.

• Mycobiology
• /
• v.47 no.2
• /
• pp.200-206
• /
• 2019

Allelic differences in A and B mating-type loci are a prerequisite for the progression of mating in the genus Pleurotus eryngii; thus, the crossing is hampered by this biological barrier in inbreeding. Molecular markers linked to mating types of P. eryngii KNR2312 were investigated with randomly amplified polymorphic DNA to enhance crossing efficiency. An A4-linked sequence was identified and used to find the adjacent genomic region with the entire motif of the A locus from a contig sequenced by PacBio. The sequence-characterized amplified region marker $7-2_{299}$ distinguished A4 mating-type monokaryons from KNR2312 and other strains. A BLAST search of flanked sequences revealed that the A4 locus had a general feature consisting of the putative HD1 and HD2 genes. Both putative HD transcription factors contain a homeodomain sequence and a nuclear localization sequence; however, valid dimerization motifs were found only in the HD1 protein. The ACAAT motif, which was reported to have relevance to sex determination, was found in the intergenic region. The SCAR marker could be applicable in the classification of mating types in the P. eryngii breeding program, and the A4 locus could be the basis for a multi-allele detection marker.

• Asian-Australasian Journal of Animal Sciences
• /
• v.14 no.11
• /
• pp.1505-1510
• /
• 2001

A method for mapping quantitative trait loci (QTL) was introduced incorporating the information of mixed progeny from complex pedigrees. The method consisted of two steps based on single marker analysis. The first step was to examine the marker-trait association with a mixed model considering common environmental effect and reversed QTL-marker linkage phase. The second step was to estimate QTL effects by a weighted least square analysis. A simulation study indicated that the method incorporating mixed progeny from multiple generations improved the accuracy of QTL detection. The influence of within-genotype variance and recombination rate on QTL analysis was further examined. Detecting a QTL with a large within-genotype variance was more difficult than with a small within-genotype variance. Most of the significant marker-QTL association was detectable when the recombination rate was less than 15%.

• KSBB Journal
• /
• v.17 no.1
• /
• pp.106-109
• /
• 2002

Gel electrophoresis of DNA is a well known technique in molecular biology. This technique is simple, rapid to perform, and capable of adequately separating fragments of DNA. A number of mixtures of DNA fragments ("DNA size markers") are frequently employed in a purpose of extrapolating the sizes or the amount of DNA molecules during gel electrophoresis. DNA size markers are constructed by digesting plasmid DNA, bacteriophage DNA, or recombinant DNA molecules with one or more restriction enzymes. However, liquid suspension containing DNA size marker needs to be kept at a low temperature during storage and shipping. In an attempt to maintain the DNA samples at room temperature for extended period of time, lyophilization of DNA with addition of nuclease inhibitor was studied. Gel loading buffer was also added to the lyophilized DNA to provide additional convenience such that DNA size marker was the "ready-to-use" followed by simply reconstituting with distilled water.

• Journal of Chest Surgery
• /
• v.30 no.7
• /
• pp.701-707
• /
• 1997

Although many reseraches have been persued to detect the molecular tumor marker to define the cancer, ideal tumor marker which speak for the characteristics of malignancy and has high sensitivity and specificity is not known. One of the characteristics of the malignant cells is indefinite proliferative potential, in other word, immortality. The expression of telomerase and stabilization of te10meres are con omitant with the attaiunent of immortality in tumor cells; thus the measurement of telomerase activity in clinically obtained tumor samples may provide important information which would be useful as a diagnostic marker to detect immortal cancer cells. Telomerase activity was analyzed in 12 non-small cell . lung cancer cell lines and 41 primary non-small cell lung cancers with the use of a PCR-based assay. All the cell lines and the majority of tumors displayed telomerase activity, but telomerase was not detectable in most of the corresponding pathologically-normal tissues. Telomere length was not correlated with telomerase activity. The present study indicate that measurement of telomerase activity may be useful as a molecular tumor marker in non-small cell lung cancer.

• Horticultural Science & Technology
• /
• v.34 no.1
• /
• pp.134-141
• /
• 2016

The DNA marker T1ex, originally developed from melon (Cucumis melo L.) for monoecy, was employed in chamoe, which is referred to as oriental melon. This marker shows size variations in monoecious melon. However, in chamoe, no such detrimental size variation was found in monoecious chamoe, and 99% association between flower phenotypes and genotypes of the T1ex marker was observed in 106 lines of chamoe. To evaluate the efficacy of the T1ex marker for marker-assisted selection (MAS), a total of 240 plants of chamoe breeding lines were screened using the T1ex marker. Among these, 98 varieties were selected. Although the T1ex marker might not be useful for MAS in melon, we found 100% concordance between genotypes and phenotypes for sex expression in chamoe. These results suggest that the T1ex marker will be a useful resource for MAS for monoecy in chamoe.

• BMB Reports
• /
• v.36 no.2
• /
• pp.173-178
• /
• 2003

Malignant melanoma is one of the most rapidly increasing cancer types, and patients with metastatic disease have a very poor prognosis. Detection of metastatic melanoma cells in circulation may aid the clinician in assessing tumor progression, metastatic potential, and response to therapy. Tyrosinase is a key enzyme in melanine biosynthesis. The gene is actively expressed in melanocytes and melanoma cells. Melan A is a differentiation antigen that is expressed in melanocytes. The presence of these molecules in blood is considered a marker for circulating melanoma cells. In this study, we analyzed the usefulness of this marker combination I evaluating the response to therapy in the blood of 30 patients with malignant melanoma. Circulating cells were detected by a reverse-transcriptase-polymerase-chain reaction. The tyrosinase expression was observed in 9 (30%) patients and Melan A in 19 (63.3%) patients before therapy. Following treatment, the tyrosinase mRNA was detected in only one patient, while Melan A transcripts were still present in 14 patients. We suggest that this molecular assay can identify circulating melanoma cells that express melanoma-associated antigens and may provide an early indication of therapy effectiveness.

• Journal of Plant Biotechnology
• /
• v.43 no.1
• /
• pp.76-81
• /
• 2016

We performed a molecular marker-based analysis of quantitative trait loci for traits that determine the quality of appearance of grains using 120 doubled haploid lines developed by anther culture from the F1 cross between 'Cheongcheong' (Oryza sativa L. ssp. Indica) and 'Nagdong' (Oryza sativa L. ssp. Japonica). We therefore calculated the alkali digestion value (ADV), used to indirectly measure gelatinization temperature, to evaluate the quality of cooked rice in 2013 and 2014. The ADV score of frequency distribution was higher milled rice than brown rice. In total, nine different quantitative trait loci (QTLs) were found on 5 chromosomes in 2013 and 2014. Also, chromosome 5, 8 were detected over two years. We conclude that selected molecular markers from this QTL analysis could be exploited in future rice quality. In conclusion, we investigated ADV of brown and milled rice in CNDH population. This study found nine QTLs related to the ADV of brown and milled rice. The detected one marker can be used to select lines with desirable eating-quality traits because ADV is closely associated with the eating quality of cooked rice. Therefore, it will be useful to collect resources and distinguishable in many varieties for rice breeding program.

• Biotechnology and Bioprocess Engineering:BBE
• /
• v.9 no.3
• /
• pp.217-222
• /
• 2004

As Agrobacterium tumefaciens, which has long been used to transform plants, is known to transfer T-DNA to budding yeast, Saccharomyces cerevisiae, a variety of fungi were subjected to the A. tumefaciens-mediated transformation to improve their transformation frequency and feasibility. The A. tumefaciens-mediated transformation of chestnut blight fungus, Cryphonectria parasitica, is performed in this study as the first example of transformation of a hardwood fungal pathogen. The transfer of the binary vector pBIN9-Hg, containing the bacterial hygromycin B phosphotransferase gene under the control of the Aspergillus nidulans trpC promoter and terminator, as a selectable marker, led to the selection of more than 1,000 stable, hygromycin B-resistant transformants per 1${\times}$10$\^$6/ conidia of C. parasitica. The putative transformants appeared to be mitotically stable. The transformation efficiency appears to depend on the bacterial strain, age of the bacteria cell culture and ratio of fungal spores to bacterial cells. PCR and Southern blot analysis indicated that the marker gene was inserted at different chromosomal sites. Moreover, three transformants out of ten showed more than two hybridizing bands, suggesting more than two copies of the inserted marker gene are not uncommon.

• Journal of Microbiology
• /
• v.39 no.1
• /
• pp.56-61
• /
• 2001

Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.