• Journal of Ecology and Environment
• /
• 제45권4호
• /
• pp.228-236
• /
• 2021

Background: A review of the literature was carried out to study dust and sandstorm (DSS) in terms of its ecosystem processes and relationship to other dryland disasters in Northeast Asia. Drylands are ecosystems that include grasslands, semi-deserts, and deserts, and these types of ecosystems are vulnerable due to their low primary productivity that depends on a small amount of precipitation. Results: Drought, dust, desertification, and winter livestock disasters (called dzud) are unique natural disasters that affect the region. These disasters are related in that they share major causes, such as dryness and low vegetation cover that combine with other conditions, wind, cold waves, livestock, and land-surface energy, to dramatically impact the ecosystem. Conclusions: The literature review in this study illustrates the macroscopic context of the spatial and temporal patterns of DSS according to geography, climate, and vegetation growth in the drylands of Northeast Asia. The effects of ocean climates and human activities were discussed to infer a possible teleconnection effect of DSS and its relations to desertification and dzud.

• 한국동물위생학회지
• /
• 제46권1호
• /
• pp.81-85
• /
• 2023

This case report is about hemolymph nodes found in a dairy cow whose function is still not fully elucidated. A 4-month Holstein cow presented severe respiratory symptoms and hematochezia for a while with respiratory acidosis and metabolic alkalosis. Coccidiosis was diagnosed and treated immediately, but the cow died from respiratory acidosis and metabolic alkalosis. At necropsy, no abnormal appearance in thoracic and peritoneal organs was observed, but hemolymph nodes were observed being multifocally stuck on omasum serosa and the subcutaneous fascia of abdominal region, and the larger dark red lymph nodes were found along the omasum great curvature. Microscopically, lymphoid depletion and lymphadenitis in the lymph nodes were examined to point systemic infection, and in the hemolymph node, multifocally demarcated pale lesions with macrophage infiltration and fibrin deposition nearby subcapsular sinus. In subcapsular sinus of the hemolymph node, rod to linear gram-negative bacteria were found. Through this study, we might conclude that the hemolymph node is involved in pathogen phagocytosis.

• Journal of Microbiology
• /
• 제39권1호
• /
• pp.56-61
• /
• 2001

Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.

• Journal of Plant Biotechnology
• /
• 제7권4호
• /
• pp.225-231
• /
• 2005

Five day old cotyledon explants of Cucumber (Cucumis sativus L) cv Poinsett 76 were cocultivated with two Agrobacterium strains (EHA105 and LBA 4404) each carrying GUS as the reporter gene and npt-II as the selection marker gene in the T-DNA region of the vector. Transformed shoots were selected at 150 mg/L kanamycin. A two day cocultivation coupled with $20\;{\mu}M$ acetosyringone increased the frequency (8.2 and 15.4 shoots) of GUS expression in the shoots of transformed plant. Among the two Agrobacterium strains, EHA 105 performed better than LBA 4404 in bringing two-fold increase in transformation efficiency (14%) than LBA 4404 (7.4%). PCR analysis was done to confirm the integration of T-DNA into cucumber genome.

• 전기학회논문지
• /
• 제67권7호
• /
• pp.928-933
• /
• 2018

Nowadays, gastropathy is a common disease. As endoscopic equipment are developed and used widely, it is possible to provide a large number of endoscopy images. Computer-aided Diagnosis (CADx) systems aim at helping physicians to identify possibly malignant abnormalities more accurately. In this paper, we present a CADx system to detect and classify the abnormalities of gastric lesions which include bleeding, ulcer, neuroendocrine tumor and cancer. We used an Inception module based deep learning model. And we used data augmentation for learning. Our preliminary results demonstrated promising potential for automatically labeled region of interest for endoscopy doctors to focus on abnormal lesions for subsequent targeted biopsy, with Az values of Receiver Operating Characteristic(ROC) curve was 0.83. The proposed CADx system showed reliable performance.

• Journal of Electrical Engineering and Technology
• /
• 제12권4호
• /
• pp.1593-1599
• /
• 2017

This paper presents a multi-channel light-emitting diode (LED) driver IC with a current-mode current regulator. The proposed current regulator replaces resistors for current sensing with a sequentially controlled single current sensor and a single regulation loop for sensing and regulating all LED channel currents. This minimizes the current mismatch among the LED channels and increases voltage headroom or, equivalently, power efficiency. The proposed LED driver IC was fabricated in a $0.35-{\mu}m$ BCD 60-V high voltage process, and the chip area is $1.06mm^2$. The measured maximum power efficiency is 93.4 % from a 12-V input, and the inter-channel current error is smaller than as low as ${\pm}1.3%$ in overall operating region.

• 한국방송∙미디어공학회:학술대회논문집
• /
• 한국방송공학회 2013년도 하계학술대회
• /
• pp.366-367
• /
• 2013

3D Conversion은 3DTV 및 3D Display에 장착되어 제공되고 있다. 이외에도 다양한 변환 방법이 제안되어 왔다 기존 방법들은 영화나 애니메이션 같은 자연영상을 3D로 변환하는 것에 초점이 맞추어져 있었다. 따라서 자동 3D변환에서는 webpage영상처럼 텍스트, 이미지, 로고 등의 혼재되어 있는 영상을 처리하는데 어려움이 있다. 특히 텍스트는 동일한 깊이맵을 얻지 못하면, 깨짐, 흔들림 등의 문제점이 발생한다. 해결방법으로 webpage에서 image region만을 탐색해서, 3D변환을 하고, 다른 영역은 2D로 처리함으로써 상기 문제점을 극복할 수 있다. 이를 위해 본 논문에서는 변환하려는 영상 영역을 탐색하고 이 탐색된 영상들을 단순하게 픽셀의 수평이동이 아닌, 양선형 보간으로 변환하여 홀채움 문제를 극복할 수 있는 변환방법을 제안한다.

• Bulletin of the Korean Chemical Society
• /
• 제32권7호
• /
• pp.2332-2338
• /
• 2011

In this study, we proposed a new promising idea of utilizing moving window principal component analysis (MWPCA) as a sensitive diagnostic tool to detect the presence of peak position shift. In this approach, the moving window is constructed from a small data segment along the wavenumber axis. For each window bound by a narrow wavenumber region, separate PCA analysis was applied. Simulated spectra with complex spectral feature variations were analyzed to explore the possibility of MWPCA technique. This MWPCA-based detection of the peak shift, potentially coupled with 2D correlation analysis to provide additional verification, may offer an attractive solution.

• Mycobiology
• /
• 제33권4호
• /
• pp.235-239
• /
• 2005

The present study was carried out to explore the Cordyceps species and other entomopathogenic fungal flora around Kathmandu Valley and a few high altitude locations of Nepal. In this paper, we report eight Cordyceps species as new to Nepal: C. gracilis, C. ishikariensis, C. liangshanensis, C. martialis, C. militaris, C. pruinosa, C. sphecocephala and C. tricentri. We also mention a few allied genera such as Beauveria, Hirsutella and Paecilomyces from Nepal. Further collections from different ecological regions of Nepal will show the richness of entomopathogenic fungal floral diversity of Nepal.

• 대한전기학회:학술대회논문집
• /
• 대한전기학회 2001년도 하계학술대회 논문집 A
• /
• pp.13-15
• /
• 2001

본 논문은 최근 3년간 강원 영서 지역에서 실측한 전원의 고조파 함유량을 토대로 전압 고조파, 중성선 전류 고조파 및 고조파로 인한 역율 저하를 분석하였다. 전압 고조파의 종합 왜형율(THD)은 순시 측정시 적합율 88.5%, 24시간 측정시 42.9%로 나타났으며, 중성선 전류의 종합 왜형율은 1,000%를 상회하는 장소가 20%를 차지하고 있어 심각한 문제점들이 발생될 수 있음을 알았다. 또한, 종합 고조파 왜형율의 증가로 인한 역율 저하는 평균 2%정도 발생되었다.