Kang, Sinkyu;Lee, Sang Hun;Cho, Nanghyun;Aggossou, Casmir;Chun, Jungwha
Journal of Ecology and Environment
/
제45권4호
/
pp.228-236
/
2021
Background: A review of the literature was carried out to study dust and sandstorm (DSS) in terms of its ecosystem processes and relationship to other dryland disasters in Northeast Asia. Drylands are ecosystems that include grasslands, semi-deserts, and deserts, and these types of ecosystems are vulnerable due to their low primary productivity that depends on a small amount of precipitation. Results: Drought, dust, desertification, and winter livestock disasters (called dzud) are unique natural disasters that affect the region. These disasters are related in that they share major causes, such as dryness and low vegetation cover that combine with other conditions, wind, cold waves, livestock, and land-surface energy, to dramatically impact the ecosystem. Conclusions: The literature review in this study illustrates the macroscopic context of the spatial and temporal patterns of DSS according to geography, climate, and vegetation growth in the drylands of Northeast Asia. The effects of ocean climates and human activities were discussed to infer a possible teleconnection effect of DSS and its relations to desertification and dzud.
This case report is about hemolymph nodes found in a dairy cow whose function is still not fully elucidated. A 4-month Holstein cow presented severe respiratory symptoms and hematochezia for a while with respiratory acidosis and metabolic alkalosis. Coccidiosis was diagnosed and treated immediately, but the cow died from respiratory acidosis and metabolic alkalosis. At necropsy, no abnormal appearance in thoracic and peritoneal organs was observed, but hemolymph nodes were observed being multifocally stuck on omasum serosa and the subcutaneous fascia of abdominal region, and the larger dark red lymph nodes were found along the omasum great curvature. Microscopically, lymphoid depletion and lymphadenitis in the lymph nodes were examined to point systemic infection, and in the hemolymph node, multifocally demarcated pale lesions with macrophage infiltration and fibrin deposition nearby subcapsular sinus. In subcapsular sinus of the hemolymph node, rod to linear gram-negative bacteria were found. Through this study, we might conclude that the hemolymph node is involved in pathogen phagocytosis.
Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.
Sureshkumar P.;Selvaraj N.;Ganapathi A.;Kasthurirengan S.;Vasudevan A.;Anbazhagan V. Ramesh
Journal of Plant Biotechnology
/
제7권4호
/
pp.225-231
/
2005
Five day old cotyledon explants of Cucumber (Cucumis sativus L) cv Poinsett 76 were cocultivated with two Agrobacterium strains (EHA105 and LBA 4404) each carrying GUS as the reporter gene and npt-II as the selection marker gene in the T-DNA region of the vector. Transformed shoots were selected at 150 mg/L kanamycin. A two day cocultivation coupled with $20\;{\mu}M$ acetosyringone increased the frequency (8.2 and 15.4 shoots) of GUS expression in the shoots of transformed plant. Among the two Agrobacterium strains, EHA 105 performed better than LBA 4404 in bringing two-fold increase in transformation efficiency (14%) than LBA 4404 (7.4%). PCR analysis was done to confirm the integration of T-DNA into cucumber genome.
Nowadays, gastropathy is a common disease. As endoscopic equipment are developed and used widely, it is possible to provide a large number of endoscopy images. Computer-aided Diagnosis (CADx) systems aim at helping physicians to identify possibly malignant abnormalities more accurately. In this paper, we present a CADx system to detect and classify the abnormalities of gastric lesions which include bleeding, ulcer, neuroendocrine tumor and cancer. We used an Inception module based deep learning model. And we used data augmentation for learning. Our preliminary results demonstrated promising potential for automatically labeled region of interest for endoscopy doctors to focus on abnormal lesions for subsequent targeted biopsy, with Az values of Receiver Operating Characteristic(ROC) curve was 0.83. The proposed CADx system showed reliable performance.
This paper presents a multi-channel light-emitting diode (LED) driver IC with a current-mode current regulator. The proposed current regulator replaces resistors for current sensing with a sequentially controlled single current sensor and a single regulation loop for sensing and regulating all LED channel currents. This minimizes the current mismatch among the LED channels and increases voltage headroom or, equivalently, power efficiency. The proposed LED driver IC was fabricated in a $0.35-{\mu}m$ BCD 60-V high voltage process, and the chip area is $1.06mm^2$. The measured maximum power efficiency is 93.4 % from a 12-V input, and the inter-channel current error is smaller than as low as ${\pm}1.3%$ in overall operating region.
3D Conversion은 3DTV 및 3D Display에 장착되어 제공되고 있다. 이외에도 다양한 변환 방법이 제안되어 왔다 기존 방법들은 영화나 애니메이션 같은 자연영상을 3D로 변환하는 것에 초점이 맞추어져 있었다. 따라서 자동 3D변환에서는 webpage영상처럼 텍스트, 이미지, 로고 등의 혼재되어 있는 영상을 처리하는데 어려움이 있다. 특히 텍스트는 동일한 깊이맵을 얻지 못하면, 깨짐, 흔들림 등의 문제점이 발생한다. 해결방법으로 webpage에서 image region만을 탐색해서, 3D변환을 하고, 다른 영역은 2D로 처리함으로써 상기 문제점을 극복할 수 있다. 이를 위해 본 논문에서는 변환하려는 영상 영역을 탐색하고 이 탐색된 영상들을 단순하게 픽셀의 수평이동이 아닌, 양선형 보간으로 변환하여 홀채움 문제를 극복할 수 있는 변환방법을 제안한다.
In this study, we proposed a new promising idea of utilizing moving window principal component analysis (MWPCA) as a sensitive diagnostic tool to detect the presence of peak position shift. In this approach, the moving window is constructed from a small data segment along the wavenumber axis. For each window bound by a narrow wavenumber region, separate PCA analysis was applied. Simulated spectra with complex spectral feature variations were analyzed to explore the possibility of MWPCA technique. This MWPCA-based detection of the peak shift, potentially coupled with 2D correlation analysis to provide additional verification, may offer an attractive solution.
The present study was carried out to explore the Cordyceps species and other entomopathogenic fungal flora around Kathmandu Valley and a few high altitude locations of Nepal. In this paper, we report eight Cordyceps species as new to Nepal: C. gracilis, C. ishikariensis, C. liangshanensis, C. martialis, C. militaris, C. pruinosa, C. sphecocephala and C. tricentri. We also mention a few allied genera such as Beauveria, Hirsutella and Paecilomyces from Nepal. Further collections from different ecological regions of Nepal will show the richness of entomopathogenic fungal floral diversity of Nepal.
본 논문은 최근 3년간 강원 영서 지역에서 실측한 전원의 고조파 함유량을 토대로 전압 고조파, 중성선 전류 고조파 및 고조파로 인한 역율 저하를 분석하였다. 전압 고조파의 종합 왜형율(THD)은 순시 측정시 적합율 88.5%, 24시간 측정시 42.9%로 나타났으며, 중성선 전류의 종합 왜형율은 1,000%를 상회하는 장소가 20%를 차지하고 있어 심각한 문제점들이 발생될 수 있음을 알았다. 또한, 종합 고조파 왜형율의 증가로 인한 역율 저하는 평균 2%정도 발생되었다.
본 웹사이트에 게시된 이메일 주소가 전자우편 수집 프로그램이나
그 밖의 기술적 장치를 이용하여 무단으로 수집되는 것을 거부하며,
이를 위반시 정보통신망법에 의해 형사 처벌됨을 유념하시기 바랍니다.
[게시일 2004년 10월 1일]
이용약관
제 1 장 총칙
제 1 조 (목적)
이 이용약관은 KoreaScience 홈페이지(이하 “당 사이트”)에서 제공하는 인터넷 서비스(이하 '서비스')의 가입조건 및 이용에 관한 제반 사항과 기타 필요한 사항을 구체적으로 규정함을 목적으로 합니다.
제 2 조 (용어의 정의)
① "이용자"라 함은 당 사이트에 접속하여 이 약관에 따라 당 사이트가 제공하는 서비스를 받는 회원 및 비회원을
말합니다.
② "회원"이라 함은 서비스를 이용하기 위하여 당 사이트에 개인정보를 제공하여 아이디(ID)와 비밀번호를 부여
받은 자를 말합니다.
③ "회원 아이디(ID)"라 함은 회원의 식별 및 서비스 이용을 위하여 자신이 선정한 문자 및 숫자의 조합을
말합니다.
④ "비밀번호(패스워드)"라 함은 회원이 자신의 비밀보호를 위하여 선정한 문자 및 숫자의 조합을 말합니다.
제 3 조 (이용약관의 효력 및 변경)
① 이 약관은 당 사이트에 게시하거나 기타의 방법으로 회원에게 공지함으로써 효력이 발생합니다.
② 당 사이트는 이 약관을 개정할 경우에 적용일자 및 개정사유를 명시하여 현행 약관과 함께 당 사이트의
초기화면에 그 적용일자 7일 이전부터 적용일자 전일까지 공지합니다. 다만, 회원에게 불리하게 약관내용을
변경하는 경우에는 최소한 30일 이상의 사전 유예기간을 두고 공지합니다. 이 경우 당 사이트는 개정 전
내용과 개정 후 내용을 명확하게 비교하여 이용자가 알기 쉽도록 표시합니다.
제 4 조(약관 외 준칙)
① 이 약관은 당 사이트가 제공하는 서비스에 관한 이용안내와 함께 적용됩니다.
② 이 약관에 명시되지 아니한 사항은 관계법령의 규정이 적용됩니다.
제 2 장 이용계약의 체결
제 5 조 (이용계약의 성립 등)
① 이용계약은 이용고객이 당 사이트가 정한 약관에 「동의합니다」를 선택하고, 당 사이트가 정한
온라인신청양식을 작성하여 서비스 이용을 신청한 후, 당 사이트가 이를 승낙함으로써 성립합니다.
② 제1항의 승낙은 당 사이트가 제공하는 과학기술정보검색, 맞춤정보, 서지정보 등 다른 서비스의 이용승낙을
포함합니다.
제 6 조 (회원가입)
서비스를 이용하고자 하는 고객은 당 사이트에서 정한 회원가입양식에 개인정보를 기재하여 가입을 하여야 합니다.
제 7 조 (개인정보의 보호 및 사용)
당 사이트는 관계법령이 정하는 바에 따라 회원 등록정보를 포함한 회원의 개인정보를 보호하기 위해 노력합니다. 회원 개인정보의 보호 및 사용에 대해서는 관련법령 및 당 사이트의 개인정보 보호정책이 적용됩니다.
제 8 조 (이용 신청의 승낙과 제한)
① 당 사이트는 제6조의 규정에 의한 이용신청고객에 대하여 서비스 이용을 승낙합니다.
② 당 사이트는 아래사항에 해당하는 경우에 대해서 승낙하지 아니 합니다.
- 이용계약 신청서의 내용을 허위로 기재한 경우
- 기타 규정한 제반사항을 위반하며 신청하는 경우
제 9 조 (회원 ID 부여 및 변경 등)
① 당 사이트는 이용고객에 대하여 약관에 정하는 바에 따라 자신이 선정한 회원 ID를 부여합니다.
② 회원 ID는 원칙적으로 변경이 불가하며 부득이한 사유로 인하여 변경 하고자 하는 경우에는 해당 ID를
해지하고 재가입해야 합니다.
③ 기타 회원 개인정보 관리 및 변경 등에 관한 사항은 서비스별 안내에 정하는 바에 의합니다.
제 3 장 계약 당사자의 의무
제 10 조 (KISTI의 의무)
① 당 사이트는 이용고객이 희망한 서비스 제공 개시일에 특별한 사정이 없는 한 서비스를 이용할 수 있도록
하여야 합니다.
② 당 사이트는 개인정보 보호를 위해 보안시스템을 구축하며 개인정보 보호정책을 공시하고 준수합니다.
③ 당 사이트는 회원으로부터 제기되는 의견이나 불만이 정당하다고 객관적으로 인정될 경우에는 적절한 절차를
거쳐 즉시 처리하여야 합니다. 다만, 즉시 처리가 곤란한 경우는 회원에게 그 사유와 처리일정을 통보하여야
합니다.
제 11 조 (회원의 의무)
① 이용자는 회원가입 신청 또는 회원정보 변경 시 실명으로 모든 사항을 사실에 근거하여 작성하여야 하며,
허위 또는 타인의 정보를 등록할 경우 일체의 권리를 주장할 수 없습니다.
② 당 사이트가 관계법령 및 개인정보 보호정책에 의거하여 그 책임을 지는 경우를 제외하고 회원에게 부여된
ID의 비밀번호 관리소홀, 부정사용에 의하여 발생하는 모든 결과에 대한 책임은 회원에게 있습니다.
③ 회원은 당 사이트 및 제 3자의 지적 재산권을 침해해서는 안 됩니다.
제 4 장 서비스의 이용
제 12 조 (서비스 이용 시간)
① 서비스 이용은 당 사이트의 업무상 또는 기술상 특별한 지장이 없는 한 연중무휴, 1일 24시간 운영을
원칙으로 합니다. 단, 당 사이트는 시스템 정기점검, 증설 및 교체를 위해 당 사이트가 정한 날이나 시간에
서비스를 일시 중단할 수 있으며, 예정되어 있는 작업으로 인한 서비스 일시중단은 당 사이트 홈페이지를
통해 사전에 공지합니다.
② 당 사이트는 서비스를 특정범위로 분할하여 각 범위별로 이용가능시간을 별도로 지정할 수 있습니다. 다만
이 경우 그 내용을 공지합니다.
제 13 조 (홈페이지 저작권)
① NDSL에서 제공하는 모든 저작물의 저작권은 원저작자에게 있으며, KISTI는 복제/배포/전송권을 확보하고
있습니다.
② NDSL에서 제공하는 콘텐츠를 상업적 및 기타 영리목적으로 복제/배포/전송할 경우 사전에 KISTI의 허락을
받아야 합니다.
③ NDSL에서 제공하는 콘텐츠를 보도, 비평, 교육, 연구 등을 위하여 정당한 범위 안에서 공정한 관행에
합치되게 인용할 수 있습니다.
④ NDSL에서 제공하는 콘텐츠를 무단 복제, 전송, 배포 기타 저작권법에 위반되는 방법으로 이용할 경우
저작권법 제136조에 따라 5년 이하의 징역 또는 5천만 원 이하의 벌금에 처해질 수 있습니다.
제 14 조 (유료서비스)
① 당 사이트 및 협력기관이 정한 유료서비스(원문복사 등)는 별도로 정해진 바에 따르며, 변경사항은 시행 전에
당 사이트 홈페이지를 통하여 회원에게 공지합니다.
② 유료서비스를 이용하려는 회원은 정해진 요금체계에 따라 요금을 납부해야 합니다.
제 5 장 계약 해지 및 이용 제한
제 15 조 (계약 해지)
회원이 이용계약을 해지하고자 하는 때에는 [가입해지] 메뉴를 이용해 직접 해지해야 합니다.
제 16 조 (서비스 이용제한)
① 당 사이트는 회원이 서비스 이용내용에 있어서 본 약관 제 11조 내용을 위반하거나, 다음 각 호에 해당하는
경우 서비스 이용을 제한할 수 있습니다.
- 2년 이상 서비스를 이용한 적이 없는 경우
- 기타 정상적인 서비스 운영에 방해가 될 경우
② 상기 이용제한 규정에 따라 서비스를 이용하는 회원에게 서비스 이용에 대하여 별도 공지 없이 서비스 이용의
일시정지, 이용계약 해지 할 수 있습니다.
제 17 조 (전자우편주소 수집 금지)
회원은 전자우편주소 추출기 등을 이용하여 전자우편주소를 수집 또는 제3자에게 제공할 수 없습니다.
제 6 장 손해배상 및 기타사항
제 18 조 (손해배상)
당 사이트는 무료로 제공되는 서비스와 관련하여 회원에게 어떠한 손해가 발생하더라도 당 사이트가 고의 또는 과실로 인한 손해발생을 제외하고는 이에 대하여 책임을 부담하지 아니합니다.
제 19 조 (관할 법원)
서비스 이용으로 발생한 분쟁에 대해 소송이 제기되는 경우 민사 소송법상의 관할 법원에 제기합니다.
[부 칙]
1. (시행일) 이 약관은 2016년 9월 5일부터 적용되며, 종전 약관은 본 약관으로 대체되며, 개정된 약관의 적용일 이전 가입자도 개정된 약관의 적용을 받습니다.