• The Korea Journal of Herbology
• /
• v.37 no.4
• /
• pp.9-16
• /
• 2022

Objectives : In the Korean Pharmacopoeia 12th edition (KP 12) and the Korean Herbal Pharmacopoeia (KHP), two authentic herbal medicines are described, namely Bang-gi (Cheong-pung-deung) and Mok-bang-gi, respectively. In China, Bun-bang-gi is also used as herbal medicine. This study was conducted to develop a molecular authentication tool for distinguishing the three herbal medicine used as Bang-gi, which are Sinomeni Caulis et Rhizoma (Rhizome of Sinomenium acutum), Stephaniae Tetrandrae Radix (Root of Stephania terandra), and Cocculi Radix (Root of Cocculus trilobus). Methods : Twelve samples of three species (four samples of S. acutum, five samples of S. tetrandra, and three samples of C. trilobus) were collected from different habitats. The sequences of internal transcribed spacer (ITS) regions were obtained and comparatively analyzed to design the species-specific sequence characterized amplified region (SCAR) primers. The specificity of each pair of SCAR primers that amplified species-specific amplicon was evaluated for establishing the singleplex and multiplex PCR assay tools. Results : The singleplex SCAR markers show discriminability in C. acutum, S. tetrandra, and C. trilobus. These SCAR markers were also efficiently authenticated three species in the multiplex SCAR amplification using single PCR reaction. Furthermore, these PCR assay methods were applicable to authenticate dried herbal medicines distributed in the markets. Conclusions : The SCAR markers and PCR assay tools help discriminate the three herbal medicines used as Bang-gi at the species levels and provide a reliable genetic method to prevent the inauthentic distribution of these herbal medicines.

• ALGAE
• /
• v.29 no.2
• /
• pp.75-99
• /
• 2014

A small dinoflagellate, Ansanella granifera gen. et sp. nov., was isolated from estuarine and marine waters, and examined by light microscopy, scanning electron microscopy, and transmission electron microscopy. In addition, the identity of the sequences (3,663-bp product) of the small subunit (SSU), internal transcribed spacer (ITS) region (ITS1, 5.8S, ITS2), and D1-D3 large subunit (LSU) rDNA were determined. This newly isolated, thin-walled dinoflagellate has a type E eyespot and a single elongated apical vesicle, and it is closely related to species belonging to the family Suessiaceae. A. granifera has 10-14 horizontal rows of amphiesmal vesicles, comparable to Biecheleria spp. and Biecheleriopsis adriatica, but greater in number than in other species of the family Suessiaceae. Unlike Biecheleria spp. and B. adriatica, A. granifera has grana-like thylakoids. Further, A. granifera lacks a nuclear fibrous connective, which is present in B. adriatica. B. adriatica and A. granifera also show a morphological difference in the shape of the margin of the cingulum. In A. granifera, the cingular margin formed a zigzag line, and in B. adriatica a straight line, especially on the dorsal side of the cell. The episome is conical with a round apex, whereas the hyposome is trapezoidal. Cells growing photosynthetically are $10.0-15.0{\mu}m$ long and $8.5-12.4{\mu}m$ wide. The cingulum is descending, the two ends displaced about its own width. Cells of A. granifera contain 5-8 peripheral chloroplasts, stalked pyrenoids, and a pusule system, but lack nuclear envelope chambers, a nuclear fibrous connective, lamellar body, rhizocysts, and a peduncle. The main accessory pigment is peridinin. The SSU, ITS regions, and D1-D3 LSU rDNA sequences differ by 1.2-7.4%, >8.8%, and >2.5%, respectively, from those of the other known genera in the order Suessiales. Moreover, the SSU rDNA sequence differed by 1-2% from that of the three most closely related species, Polarella glacialis, Pelagodinium bei, and Protodinium simplex. In addition, the ITS1-5.8S-ITS2 rDNA sequence differed by 16-19% from that of the three most closely related species, Gymnodinium corii, Pr. simplex, and Pel. bei, and the LSU rDNA sequence differed by 3-4% from that of the three most closely related species, Protodinium sp. CCMP419, B. adriatica, and Gymnodinium sp. CCMP425. A. granifera had a 51-base pair fragment in domain D2 of the large subunit of ribosomal DNA, which is absent in the genus Biecheleria. In the phylogenetic tree based on the SSU and LSU sequences, A. granifera is located in the large clade of the family Suessiaceae, but it forms an independent clade.

• Korean Journal of Environmental Biology
• /
• v.40 no.4
• /
• pp.497-509
• /
• 2022

A strain of Amphidinium species was established from samples collected from the intertidal zone of a sandy beach of Jeju Island, Korea. Its cells were 13.0-15.0 ㎛ in length and 10.0-13.0 ㎛ in width. Its cell shape was round or oval and dorsoventrally flat. A pyrenoid was located in the center of the cell and a nucleus was posteriorly located. Its epicone was small and left-deflecting. Its cingulum had V-shape on the ventral side, forming a ventral ridge and extending to the sulcus. Polygonal amphiesmal vesicles and ring-shaped body scales not described previous were observed on the surface of the cell. Its morphological features were consistent with those of previously described Amphidinium fijiense. Phylogeny based on ITS region and LSU rDNA sequences revealed that this Amphidinium isolate was clearly clustered with other A. fijiense strains, but separated from other Amphidinium species. These results indicate that this Amphidinium isolate is A. fijiense. This study reports its presence for the first time in the intertidal zone of a sandy beach of Jeju Island, Korea.

• Journal of Microbiology and Biotechnology
• /
• v.34 no.5
• /
• pp.1146-1153
• /
• 2024

The increasing economic losses associated with growth retardation caused by Enterocytozoon hepatopenaei (EHP), a microsporidian parasite infecting penaeid shrimp, require effective monitoring. The internal transcribed spacer (ITS)-1 region, the non-coding region of ribosomal clusters between 18S and 5.8S rRNA genes, is widely used in phylogenetic studies due to its high variability. In this study, the ITS-1 region sequence (~600-bp) of EHP was first identified, and primers for a polymerase chain reaction (PCR) assay targeting that sequence were designed. A newly developed nested-PCR method successfully detected the EHP in various shrimp (Penaeus vannamei and P. monodon) and related samples, including water and feces collected from Indonesia, Thailand, South Korea, India, and Malaysia. The primers did not cross-react with other hosts and pathogens, and this PCR assay is more sensitive than existing PCR detection methods targeting the small subunit ribosomal RNA (SSU rRNA) and spore wall protein (SWP) genes. Phylogenetic analysis based on the ITS-1 sequences indicated that the Indonesian strain was distinct (86.2% nucleotide sequence identity) from other strains collected from Thailand and South Korea, and also showed the internal diversity among Thailand (N = 7, divided into four branches) and South Korean (N = 5, divided into two branches) samples. The results revealed the ability of the ITS-1 region to determine the genetic diversity of EHP from different geographical origins.

• Journal of Microbiology
• /
• v.39 no.1
• /
• pp.56-61
• /
• 2001

Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.

• ALGAE
• /
• v.21 no.1
• /
• pp.11-13
• /
• 2006

In this work we report the occurrence of Scytosiphon gracilis Kogame (Scytosiphonaceae, Phaeophyceae) on the Pacific coast of Mexico. This is the first report of S. gracilis outside its previously known distribution in the western North Pacific (Korea and Japan). The identification was based on a morphological revision and a comparison of the plastid-encoded RuBisCO spacer sequences determined for Korean and Mexican algal material. Thalli were collected from the intertidal zone of Saldamando Beach, Baja California, in January 2003. The vegetative structure, as well as habitat and geographic distribution of the species are described. Reproductive structures were not found in our specimens. The poor presence/absence of S. gracilis in previous floristic studies of the area could be due to its small size and low frequency.

• Mycobiology
• /
• v.41 no.4
• /
• pp.248-251
• /
• 2013

Ganoderma is a cosmopolitan wood-rot basidiomycete that has been extensively studied for its pathogencity and medicinal properties. Identification of Ganoderma based on macro-microscopic features led to large number of synonyms which resulted in 250 taxonomic names. A Ganoderma species collected from Courtallam, Tamil Nadu was identified as G. cupreum. Phylogenetic analysis inferred from internal transcribed spacer rDNA region resolved the Indian isolate MYC1 as Ganoderma cupreum which clustered with Australian and Asian "cupreum" clade with 85% bootstrap support BS and shared 99% and 98% nucleotide similarity with Malaysian and Australian 'cupreum' respectively. This study represents the first molecular evidence of G. cupreum from Asian origin.

• Horticulture, Environment, and Biotechnology : HEB
• /
• v.59 no.6
• /
• pp.889-897
• /
• 2018

Currently, there is a lack of genetic markers capable of effectively detecting polymorphisms in Clematis. Therefore, we developed new markers to investigate inter- and intraspecific diversity in Clematis. Based on the complete chloroplast genome of Clematis terniflora, simple sequence repeats were explored and primer pairs were designed for all ten adequate repeat regions (cpSSRs), which were tested in 43 individuals of 11 Clematis species. In addition, the nuclear ITS region was sequenced in 11 Clematis species. Seven cpSSR loci were found to be polymorphic in the genus and serve as markers that can distinguish different species and be used in different genetic analyses, including cultivar identification to assist the breeding of new ornamental cultivars.

• The Korean Journal of Mycology
• /
• v.51 no.4
• /
• pp.471-490
• /
• 2023

Soil is a rich source of saprobic and pathogenic fungi in crop cultivation areas. Compared with that of the fruit trees, scarce information is available regarding the fungi present in orchard soils in Korea. We sampled rhizosphere soils of apple and pear trees from several orchards in Cheongju, Anseong, and Cheonan, Korea. During the processing of soil fungi, seven unrecorded species of the phylum Ascomycota were isolated. These included Acrocalymma walkeri, Clonostachys krabiensis, Coniella vitis, Cosmospora diminuta, Lasiobolidium spirale, Penicillium vallebormidaense, and Pseudothielavia arxii. All the species were identified and described based on morphological characteristics and molecular analysis of the ITS1-5.8S-ITS2 region and the large subunit of nuclear ribosomal RNA gene and partial β-tubulin gene (BenA) sequences. Descriptions and illustrations of the morphological characteristics are provided.

• Archives of Pharmacal Research
• /
• v.19 no.6
• /
• pp.497-501
• /
• 1996

A gene coding for triosephosphate isomerase (TPI) from a rat skeletal muscle cDNA library was cloned and its nucleotide sequence was determined. The 1, 348-bp cDNA clone contains 24 bp $5^I$ noncoding region, the entire 750 bp coding region corresponding to a protein of 249 amino acids, $547bp 3^I$ noncoding region and part of a poly(A) tail. It also contains a polyadenylation signal, AATAAA, starting from 17 bp upstream of the poly(A) tail. The calculated molecular weight of rat TPI is 27.8 kDa and the net charge is +4. The deduced amino acid sequence from rat TPI CDNA sequence has 93% and 94% homology with that of mouse and human clones, respectively. The amino acids at the residue of Asn12, Lys14, His96, Glu 166, His96, His101, Ala177, Tyr165, Glu13O, Tyr2O9, and Ser212 in catalytic site are completely identical, confirming that the functional residues in TPI proteins are highly conserved throughout evolution. The most profound characteristic of rat TPI enzyme, compared with other TPIs, is that there are five cysteine substitutions at the residue of 21, 27, 159, 195 and 204. A Glu123 instead of Gly was found in rabbit, rhesus, mouse and human sequences. Through the method of RT-PCR, the mRNA transcription level of TPI gene was found to be different among various tissues and was highest in muscle.