• Journal of Microbiology and Biotechnology
• /
• v.1 no.1
• /
• pp.45-49
• /
• 1991

The complete nucleotide sequence of alkalophilic Bacillus sp. K-17 $\beta$-xylosidase gene and its flanking regions were established. A 1263-bp of an open reading frame for $\beta$-xylosidase was observed. The molecular weight (50, 521 dalton), deduced from the nucleotide sequence of $\beta$-xylosidase gene, agreed with the result obtained by SDS-polyacrylamide gel electrophoresis of the purified enzyme (51, 000 dalton). The Shine-Dalgarno sequence, 5'-GAGGAGG-3', was found 8 bp upstream of the initiation codon ATG. The -10 sequence (TAAAAT) in the promoter region for $\beta$-xylosidase gene was similar to the consensus sequence for Bacillus subtilis RNA polymerase, whereas the -35 sequence (TCGATCA) different from all the known -35 regions in the promoter for Bacillus subtilis RNA polymerase.

• Korean Journal of Microbiology
• /
• v.24 no.3
• /
• pp.204-210
• /
• 1986

One clone(pANt32) carring tRNA/sup Arg/ gene was selected from Aspergillus total tRNA gene clones. The nucleotide sequences of this tRNA gene were determined by Maxam and Gilbert's chemical cleavage methods. The sequence of this tRNA gene is as follow; 5'GGCCGGCTGCCCAATTGGCAAGGCGTCTGACTACGAATCAGGAGAT TGCAGGTTCGAGCCCTGCGTGGGTCA3'. This sequence conicides with the characteristecs of other eukaryotic tRNA. Some consensus sequences (ACT-TA bow, TATTTT and T-cluster) are found in both 5'-end and 3'-end flanking regions.

• Journal of Microbiology and Biotechnology
• /
• v.3 no.2
• /
• pp.73-77
• /
• 1993

The nucleotide sequence of Bacillus sp. bacteriolytic enzyme gene, lytP and its flanking regions were determined. A unique open reading frame for a protein of Mw. 27, 000, and a putative terminator sequence, were found behind a concensus ribosome binding site located 8 nt upstream from ATG start codon. The primary amino acid sequence deduced from nucleotide sequence revealed a putative protein of 255 amino acid residues with an Mw. of 27, 420. No significant homology could be found between the amino acid sequence of Bacillus sp. bacteriolytic enzyme and that of other cell wall hydrolases.

• Bulletin of the Korean Chemical Society
• /
• v.28 no.6
• /
• pp.1010-1014
• /
• 2007

M1 RNA is the catalytic component of RNase P, a tRNA-processing enzyme in Escherichia coli. M1 RNA is produced in the cell by transcription of the rnpB gene and subsequent processing at the 3' end. The 3' flanking region of rnpB contains repeated sets of overlapping sequences coding for small proteins. The issue of whether these proteins are expressed remains to be established. In this study, we showed the expression of a small protein encoded by the first repeat within the 3' flanking region of rnpB. Interestingly, protein expression was increased at lower temperatures. The termination efficiency of rnpB terminators was decreased at lower temperatures, suggesting that antitermination is responsible for enhanced protein expression. Moreover, the purified small protein contained M1 RNA, implying a role as a specific RNA-binding protein.

• Journal of Plant Biotechnology
• /
• v.40 no.1
• /
• pp.27-36
• /
• 2013

We isolated and functionally characterized a Dendrobium Actin1 (DmACT1) promoter that drives strong gene expression in the orchid genus Dendrobium. A genomic fragment containing the region 3227 bp upstream of the coding region of DmACT1 was obtained by inverse PCR. Detailed comparison of the full-length cDNA and genomic sequences revealed that DmACT1 has a 1374 bp first intron in the 5' UTR. However, the 5' flanking sequences upstream of the coding region showed no obvious sequence similarities compared to those of known promoters, including plant actin promoters. Serial deletion constructs of the 5' flanking region from the translation initiation codon were fused to the coding sequence of a GUS/luciferase fusion reporter to identify the regulatory elements necessary for promoter activity. Transient assays in the flowers of Dendrobium revealed that the 5' UTR-intron greatly enhanced promoter activity. Moreover, the DmACT1 promoter with its 5' UTR-intron yielded approximately 10-fold higher reporter activity than the rice Act1 promoter-intron. Our data suggest that the DmACT1 promoter with its 5' UTR-intron is a useful tool for strong expression of transgenes in Dendrobium orchids.

• Plant Breeding and Biotechnology
• /
• v.5 no.4
• /
• pp.269-281
• /
• 2017

With the continual development of genetically modified (GM) crops, it has become necessary to develop detailed and effective molecular characterization methods to select candidate events from a large pool of transformation events. Relative to traditional molecular analysis methods such as the polymerase chain reaction (PCR) and Southern blot hybridization, next generation sequencing (NGS) technology for whole-genome sequencing of complex crop genomes had proven comparatively useful for in-depth molecular characterization. In this study, four transformation events, including one in Bacillus thuringiensis (Bt)-resistant rice, one in resveratrol-producing rice, and two in beta-carotene-enhanced soybeans, were selected for molecular characterization. To merge NGS analysis and Southern blot-hybridization results, we confirmed the transgene insertion sites, insertion construction, and insertion numbers of these four transformation events. In addition, the read-coverage depth assessed by NGS analysis for inserted genes might provide consistent results in terms of inserted T-DNA numbers in case of complex insertion structures and highly duplicated donor genomes; however, PCR-based methods can produce incorrect conclusions. Our combined method provides an effective and complete analytical approach for whole-genome visual inspection of transformation events that require biosafety assessment.

• Journal of Microbiology
• /
• v.34 no.1
• /
• pp.68-73
• /
• 1996

An nprX gene of Bacillus subtilis NS15-4 encoding a neutral protease was cloned and its molecular characteristics were analyzed. The complete nucleotide sequence indicated that there is an open reading frame (0RF) possibly encoding 521 amino acid polypeptide. The ORF used all codons expected two cysteine and a proline having a codon bias index (CBI) of 0.09 in Escherichia coli. There were homologous sequences to the consensus sequence of -35 and -10 regions of E. coli promoters and to a Shine-Dalgarno (SD) sequence located 25 bp downstream of a mojor transcription initiation site. Moreover, there were also five minor transcription initiation sites at 6. 7. 8. 14 and 15 nt downstream of the major site. Northern blot analysis revealed the presence of about 1.8 kb mRNA transcript in E. coli having the nprX gene. The nucleotide sequence was identified in GenBank to be a gene for a neutral protease of B. sutilis with six nucleotide difference in the ORF region. The flanking regions of the NprX ORF showed much more differences form those of other neutral protease genes except the nprE gene of B. subtilis, which has the most homology to the nprX gene, and of which the flanking regions were identical to those of the nprX gene.

• Proceedings of the Botanical Society of Korea Conference
• /
• 1987.07a
• /
• pp.19-49
• /
• 1987

Recent development of recombinant DNA techniques such as gene cloning and DNA sequencing has led to understanding of genetic information coded on plant genes and their application to crop improvements. Nuclear genes so far isolated and characterized at the molecular level from various plants are those involved mainly in photosynthesis, nitrogen fixation, seed development and defensive responses to environmental stresses. Most of plant genes contain intervening sequences (introns) flanked with GT and AG, as it typical of animal genes. The 5' flanking regions of plant gene revealed the presence of promoter elements such as TATAAA and CCAAT, which have been identified at animal genes to be involved in transcrip- tion initiation. The 3' untranslated regions include a sequence similar to AATAAA whcih functions as a polyadenylation signal in other eukaryotic genes. Furthermore, enhancer-type sequences were found at the 5' flanking regions of various plant genes. This indicates that the structure of plant genes is very similar to animal genes and mechanisms governing the synthesis and processing of mRNAs may be identical in higher eukaryotes. However, genes expression studies involving transformation revealed their differ ences within plants and between plant and animal systems.

• Journal of Microbiology and Biotechnology
• /
• v.4 no.4
• /
• pp.274-277
• /
• 1994

We subcloned two chicken H3 histone genes and transfected them into Rat 3 cell line. One contains 300 bp 5' to its cap site and the other contains 130 bp 5' to its cap site when cloned into plasm ids. Both of them showed 5' phase specific expression of their mRNA about 8 fold higher (during 5' phase) than during Gl phase. This means that only 130 bp 5' to its cap site was enough to confer cell cycle regulated expression of the latter gene. The DNA sequences of their 5' flanking region did not reveal any particular homologies or subtype-specific sequences. The DNA sequence data also showed that even though the protein coding regions of the histone genes have been conserved exceptionally well throughout evolution, their 5' untranslated regions have not been conserved as well.

• Journal of fish pathology
• /
• v.6 no.2
• /
• pp.93-101
• /
• 1993

The RNAI mutation of Saccharomyces cerevisia is a recessive and temperature sensitive lethal mutation which interferes with the production of mRNA, rRNA, and tRNA. However, the precise role of RNAI gene have not been revealed until yet. We have cloned rna1-1 mutant gene from rna1-1 mutant yeast strain(R49 ; trpl, ura3-52, rna1-1). The 3.4kb BglII fragment of wild type RNAI clone(81-2-6) contains whole RNAI gene. The genomic southern blotting with BglII digested R49 genomic DNA as a probe shows the unique and identical band with wild type 3.4kb BglII fragment. Therefore, We prepared partial BglII genomic library(3~4kb BglII fragments) into BamH I site of pUC19. The rna 1-1 mutant clone was screened with Digoxigenin(DIG)-lableled probe by high density colony hybridization. The 5'-flanking region of rna1-1 gene was sequenced by dideoxy chain termination method. The 5'-flanking sequence of RNAI gene contains three TATA-like sequence ; TAATA, TATA and TTTTAA at position of -67, -45, and -36 from first ATG codon respectively. The 5'-flanking region of wild type RNA I gene from ATG codon to -103nt was deleted with Bal31 exonuclease digestion, generating $pUC{\Delta}$/RNA I. After constructing $pYEP{\Delta}RNA$ I (consists of -103nt deleting RNA I gene, URA3 gene, $2{\mu}m$ rep. origin), pYEPrna1-1(consists of Xba I fragment of pUCrna1-1. URA3 gene, $2{\mu}m$ rep. origin), and pYEPRNAI. each plasmid was transformed into host strain(trpl, ura3-52, rna1-1) by electroporation, respectively. Yeast transformant carrying $pYEP{\Delta}RNA$ I did not complement the thermal sensitivity of rna1-1 gene. It means that TATA-like sequences in 5'-flanking region is not TATA sequence for transcribing RNAI gene and there may be other essential sequence in upstream region for the transcription of RNAI gene.