One clone(pANt32) carring tRNA/sup Arg/ gene was selected from Aspergillus total tRNA gene clones. The nucleotide sequences of this tRNA gene were determined by Maxam and Gilbert's chemical cleavage methods. The sequence of this tRNA gene is as follow; 5'GGCCGGCTGCCCAATTGGCAAGGCGTCTGACTACGAATCAGGAGAT TGCAGGTTCGAGCCCTGCGTGGGTCA3'. This sequence conicides with the characteristecs of other eukaryotic tRNA. Some consensus sequences (ACT-TA bow, TATTTT and T-cluster) are found in both 5'-end and 3'-end flanking regions.
Experiments were conducted to evaluate the effect of blastomere diameters and cell cycle stages on the subsequent development of nuclear transplant rabbit embryos (NT-embryos) using nuclei derived from the 16- or 32-cell stage embryos. All blastomeres and NT-embryos were cultured individually in modified Ham's F-10 medium supplemented with 10% rabbit serum (RS) at $38^{\circ}C$ and 5% $CO_2$ in air. The diameter of blastomeres from 16-cell stage embryos was found twice of those from 32-cell stage (51 vs 27 ${\mu}m$). Significant differences were observed in cleavage rates ($\geq$3 divisions) in the isolated single blastomeres (54 vs 48 for 16-cell; 28 vs 14 for 32-cell, p<0.05), but the fusion rates of oocytes with transferred nuclei were similar between small and large single blastomeres derived from either 16-cell or 32-cell stage embryos. When 16-cell stage blastomeres were used as nuclear donors, cleavage rates ($\geq$3 divisions) of the NT-embryos were greater in the small nuclear donors than in the large donors (73 vs 55%, p<0.05). On the contrary, significantly higher cleavage (43 vs 6%, p<0.05) and developmental rates (14 vs 0%, p<0.05) were observed in the large blastomere nuclear donor group of the 32-cell stage embryos. When the cell cycle stages were controlled by a microtubule polymerization inhibitor (Demicolcine, DEM) or the combined treatment of DEM and Aphidicolin (APH), a DNA polymerase inhibitor, fusion rates were 88-96% for the 16-cell donor group (without DEM treatment), which were greater than the 32-cell donor group (54-58%). Cleavage rates were also greater in the transplants derived from G1 nuclear donor group (93-95%) than those from the DEM and APH combined treatment (73%) for the 16-cell donor group (p<0.05). No significant difference was detected in the morula/blastocyst rates in either donor cell stage (p>0.05). In conclusion, it appeared that no difference in the developmental competence between large and small isolated blastomeres was observed. When smaller 16-cell stage blastomeres were used as nuclear donor, the cleavage rate or development of NT-embryos was improved and was compromised when 32-cell stage blastomeres were used. Therefore, control nuclear stage of the donor cell at $G_1$ phase in preactivated nuclear recipients seemed to be beneficial for the cleavage rate of the reconstructed embryo in the 16-cell transplant, but not for subsequent morula or blastocyst development.
Although the human genome has been nearly completely sequenced, the functions and the roles of the vast majority of the genes, and the influences of single nucleotide polymorphisms (SNPs) in these genes are not entirely known. A modified mutation detection method was developed for large-scale cloning of the possible SNPs between tumor and normal cells for facilitating the identification of genetic factors that associated with cancer formation and progression. The method involves hybridization of restriction enzyme-cut chromosomal DNA, cleavage and modification of the sites of differences by enzymes, and differential cloning of sequence variations with a designed vector. Experimental validations of the presence and location of sequence variations in the isolated clones by PCR and DNA sequencing support the capability of this method in identifying sequence differences between tumor cells and normal cells.
This study was performed to investigate the effects of anti-cancer response of Lonicerae Flos Herbal-acupuncture. Experimental studies were evaluated through the anti-cancer response activities such as, cell viability, DNA fragmentation, and Apoptosis The results obtained were summarized as follows : 1. Lonicerae Flos Herbal-acupuncture($>300mg/m{\ell}$) could lead cancer cell to cell death. 2. Lonicerae Flos herbal-acupuncture($400mg/m{\ell}$) caused DNA cleavage. 3. Lonicerae Flos herbal-acupuncture($400mg/m{\ell}$) caused apoptosis in the cancer cell line. According to above mentioned results, Lonicerae Flos Herbal- acupunctuer is expected bo by effective for anticancer response.
The novel tetranuclear nickel (II) complex is a high rate accelerator in promoting hydrolysis of phosphate diesters. Nickel-bound bis-nitrophenyl phosphate (BNPP) can be $10^4$ times more reactive than the unbound BNPP. The large rate of enhancements by the complex slightly under basic condition has shown high catalytic activity in phosphate diester cleavage. The bell-shaped pH-rate profile indicated that the nickel-oxide form of the tetranuclear complex or its kinetic equivalent was the active species for cleaving BNPP. The catalytic hydrolysis between tetranuclear nickel (II) complex and phosphate diester proceeds via the formation of bidentate coordination of the anionic phosphate to the Ni (II) atom. This reveals that the complex has the possibility as artificial nuclease.
Sphingolipids play important roles in cell regulation and signal transduction. Recently, a sphinogomyelin cycle has been described in which activation of neutral sphingomyelinase leads to the breakdown of sphingomyelin and the generation of ceramide. Ceramide, in turn, has emerged as a candidate intracellular mediator for the action of certain cell agonists and has multiple biologic actions. Ceramide is a potent suppressor of cell growth and an inducer of apoptosis. The present studies show that exposure of IM-9 cells to ceramide resulted in internucleosomal cleavage of DNA, yielding laddered patterns of oligonucleosomal fragments characteristic of apoptosis. DNA fragmentation induced by ceramide was also confirmed by diphenylamine assay. The effect of ceramide on cell cycle progression was also studied. The addition of ceramide increase G$_{1}$ phase distribution in cell cycle. Cell cycle-related cyclin D$_{1}$ gene expression was decreased in a time-dependent manner. These results suggest that apoptosis induced by ceramide is related to cell cycle associated with the alteration of cell cycle in IM-9 cells.
Mylabris phalerata(MP) is an insect that has been used for the treatment of cancer in oriental medicine. To evaluate the anticancer activity of Mylabris phalerata, We measured the cytotoxicity of Mylabris phalerata solvent fractions such as MC, EA, BuOH and residual layers on U937, human monocytic leukemia cells. Of those fractions BuOH layer of Mylabris phalerata was the most effective with ID$_{50}$ of 140$\mu\textrm{g}$/ml. It effectively caused DNA fragmentation from the concentration of 50$\mu\textrm{g}$/ml, showed apoptotic nucleus by tenets assay and expressed apototic portion stained by Annexin-V. It also induced the activation of caspase-3 and cleavage of the substrate poly (ADP-ribose) polymerase (PARP). These results suggest BuOH layer of Mylabris phalerata exerts anticancer activity by induction of apoptosis via activation of caspase-3 protease.e.
Seok, Heeyoung;Deng, Rui;Cowan, Douglas B.;Wang, Da-Zhi
Clinical and Experimental Pediatrics
/
제64권6호
/
pp.269-279
/
2021
Clustered regularly interspaced short palindromic repeats and CRISPR-associated protein 9 (CRISPR-Cas9) is an ancient prokaryotic defense system that precisely cuts foreign genomic DNA under the control of a small number of guide RNAs. The CRISPR-Cas9 system facilitates efficient double-stranded DNA cleavage that has been recently adopted for genome editing to create or correct inherited genetic mutations causing disease. Congenital heart disease (CHD) is generally caused by genetic mutations such as base substitutions, deletions, and insertions, which result in diverse developmental defects and remains a leading cause of birth defects. Pediatric CHD patients exhibit a spectrum of cardiac abnormalities such as septal defects, valvular defects, and abnormal chamber development. CHD onset occurs during the prenatal period and often results in early lethality during childhood. Because CRISPR-Cas9-based genome editing technology has gained considerable attention for its potential to prevent and treat diseases, we will review the CRISPR-Cas9 system as a genome editing tool and focus on its therapeutic application for CHD.
본 연구는 한우 체외수정란에 외래 유전자를 미세현미 주입한 후 체외 배발달을 조사하였다. DNA 미세주입은 체외수정 18~20시간 후에 DNA를 미세주입하였으며 체외 배발달율은 7일간 배양 후 조사하였다. 미세현미 주입 후 난할율은 36.3%로 대조구의 난할율 66.4% 보다 유의적으로 낮았으며(p<0.05) DNA가 주입된 수정란 중 상실배와 배반포배까지 발달율은 각각 5.6%와 1.9%로 대조구의 20.5%와 12.8%에 비하여 유의적으로 낮게 나타났다. 체외발달 배양액 내 L-ascorbic acid와 $\alpha$-tocopherol 첨가 배양시 상실배와 배반포배 발달율이 대조구에 비하여 유의적으로 높게 나타났다.(p<0.05) 따라서 미세현미 주입된 수정란의 체외 배발달 배양액에 항산화제의 첨가는 높은 체외 배발달율을 얻을 수 있으며 또한 체외성숙과, 체외 수정된 한우수정란을 이용하여 형질전환 한우 생산이 가능하리라 사료된다.
본 웹사이트에 게시된 이메일 주소가 전자우편 수집 프로그램이나
그 밖의 기술적 장치를 이용하여 무단으로 수집되는 것을 거부하며,
이를 위반시 정보통신망법에 의해 형사 처벌됨을 유념하시기 바랍니다.
[게시일 2004년 10월 1일]
이용약관
제 1 장 총칙
제 1 조 (목적)
이 이용약관은 KoreaScience 홈페이지(이하 “당 사이트”)에서 제공하는 인터넷 서비스(이하 '서비스')의 가입조건 및 이용에 관한 제반 사항과 기타 필요한 사항을 구체적으로 규정함을 목적으로 합니다.
제 2 조 (용어의 정의)
① "이용자"라 함은 당 사이트에 접속하여 이 약관에 따라 당 사이트가 제공하는 서비스를 받는 회원 및 비회원을
말합니다.
② "회원"이라 함은 서비스를 이용하기 위하여 당 사이트에 개인정보를 제공하여 아이디(ID)와 비밀번호를 부여
받은 자를 말합니다.
③ "회원 아이디(ID)"라 함은 회원의 식별 및 서비스 이용을 위하여 자신이 선정한 문자 및 숫자의 조합을
말합니다.
④ "비밀번호(패스워드)"라 함은 회원이 자신의 비밀보호를 위하여 선정한 문자 및 숫자의 조합을 말합니다.
제 3 조 (이용약관의 효력 및 변경)
① 이 약관은 당 사이트에 게시하거나 기타의 방법으로 회원에게 공지함으로써 효력이 발생합니다.
② 당 사이트는 이 약관을 개정할 경우에 적용일자 및 개정사유를 명시하여 현행 약관과 함께 당 사이트의
초기화면에 그 적용일자 7일 이전부터 적용일자 전일까지 공지합니다. 다만, 회원에게 불리하게 약관내용을
변경하는 경우에는 최소한 30일 이상의 사전 유예기간을 두고 공지합니다. 이 경우 당 사이트는 개정 전
내용과 개정 후 내용을 명확하게 비교하여 이용자가 알기 쉽도록 표시합니다.
제 4 조(약관 외 준칙)
① 이 약관은 당 사이트가 제공하는 서비스에 관한 이용안내와 함께 적용됩니다.
② 이 약관에 명시되지 아니한 사항은 관계법령의 규정이 적용됩니다.
제 2 장 이용계약의 체결
제 5 조 (이용계약의 성립 등)
① 이용계약은 이용고객이 당 사이트가 정한 약관에 「동의합니다」를 선택하고, 당 사이트가 정한
온라인신청양식을 작성하여 서비스 이용을 신청한 후, 당 사이트가 이를 승낙함으로써 성립합니다.
② 제1항의 승낙은 당 사이트가 제공하는 과학기술정보검색, 맞춤정보, 서지정보 등 다른 서비스의 이용승낙을
포함합니다.
제 6 조 (회원가입)
서비스를 이용하고자 하는 고객은 당 사이트에서 정한 회원가입양식에 개인정보를 기재하여 가입을 하여야 합니다.
제 7 조 (개인정보의 보호 및 사용)
당 사이트는 관계법령이 정하는 바에 따라 회원 등록정보를 포함한 회원의 개인정보를 보호하기 위해 노력합니다. 회원 개인정보의 보호 및 사용에 대해서는 관련법령 및 당 사이트의 개인정보 보호정책이 적용됩니다.
제 8 조 (이용 신청의 승낙과 제한)
① 당 사이트는 제6조의 규정에 의한 이용신청고객에 대하여 서비스 이용을 승낙합니다.
② 당 사이트는 아래사항에 해당하는 경우에 대해서 승낙하지 아니 합니다.
- 이용계약 신청서의 내용을 허위로 기재한 경우
- 기타 규정한 제반사항을 위반하며 신청하는 경우
제 9 조 (회원 ID 부여 및 변경 등)
① 당 사이트는 이용고객에 대하여 약관에 정하는 바에 따라 자신이 선정한 회원 ID를 부여합니다.
② 회원 ID는 원칙적으로 변경이 불가하며 부득이한 사유로 인하여 변경 하고자 하는 경우에는 해당 ID를
해지하고 재가입해야 합니다.
③ 기타 회원 개인정보 관리 및 변경 등에 관한 사항은 서비스별 안내에 정하는 바에 의합니다.
제 3 장 계약 당사자의 의무
제 10 조 (KISTI의 의무)
① 당 사이트는 이용고객이 희망한 서비스 제공 개시일에 특별한 사정이 없는 한 서비스를 이용할 수 있도록
하여야 합니다.
② 당 사이트는 개인정보 보호를 위해 보안시스템을 구축하며 개인정보 보호정책을 공시하고 준수합니다.
③ 당 사이트는 회원으로부터 제기되는 의견이나 불만이 정당하다고 객관적으로 인정될 경우에는 적절한 절차를
거쳐 즉시 처리하여야 합니다. 다만, 즉시 처리가 곤란한 경우는 회원에게 그 사유와 처리일정을 통보하여야
합니다.
제 11 조 (회원의 의무)
① 이용자는 회원가입 신청 또는 회원정보 변경 시 실명으로 모든 사항을 사실에 근거하여 작성하여야 하며,
허위 또는 타인의 정보를 등록할 경우 일체의 권리를 주장할 수 없습니다.
② 당 사이트가 관계법령 및 개인정보 보호정책에 의거하여 그 책임을 지는 경우를 제외하고 회원에게 부여된
ID의 비밀번호 관리소홀, 부정사용에 의하여 발생하는 모든 결과에 대한 책임은 회원에게 있습니다.
③ 회원은 당 사이트 및 제 3자의 지적 재산권을 침해해서는 안 됩니다.
제 4 장 서비스의 이용
제 12 조 (서비스 이용 시간)
① 서비스 이용은 당 사이트의 업무상 또는 기술상 특별한 지장이 없는 한 연중무휴, 1일 24시간 운영을
원칙으로 합니다. 단, 당 사이트는 시스템 정기점검, 증설 및 교체를 위해 당 사이트가 정한 날이나 시간에
서비스를 일시 중단할 수 있으며, 예정되어 있는 작업으로 인한 서비스 일시중단은 당 사이트 홈페이지를
통해 사전에 공지합니다.
② 당 사이트는 서비스를 특정범위로 분할하여 각 범위별로 이용가능시간을 별도로 지정할 수 있습니다. 다만
이 경우 그 내용을 공지합니다.
제 13 조 (홈페이지 저작권)
① NDSL에서 제공하는 모든 저작물의 저작권은 원저작자에게 있으며, KISTI는 복제/배포/전송권을 확보하고
있습니다.
② NDSL에서 제공하는 콘텐츠를 상업적 및 기타 영리목적으로 복제/배포/전송할 경우 사전에 KISTI의 허락을
받아야 합니다.
③ NDSL에서 제공하는 콘텐츠를 보도, 비평, 교육, 연구 등을 위하여 정당한 범위 안에서 공정한 관행에
합치되게 인용할 수 있습니다.
④ NDSL에서 제공하는 콘텐츠를 무단 복제, 전송, 배포 기타 저작권법에 위반되는 방법으로 이용할 경우
저작권법 제136조에 따라 5년 이하의 징역 또는 5천만 원 이하의 벌금에 처해질 수 있습니다.
제 14 조 (유료서비스)
① 당 사이트 및 협력기관이 정한 유료서비스(원문복사 등)는 별도로 정해진 바에 따르며, 변경사항은 시행 전에
당 사이트 홈페이지를 통하여 회원에게 공지합니다.
② 유료서비스를 이용하려는 회원은 정해진 요금체계에 따라 요금을 납부해야 합니다.
제 5 장 계약 해지 및 이용 제한
제 15 조 (계약 해지)
회원이 이용계약을 해지하고자 하는 때에는 [가입해지] 메뉴를 이용해 직접 해지해야 합니다.
제 16 조 (서비스 이용제한)
① 당 사이트는 회원이 서비스 이용내용에 있어서 본 약관 제 11조 내용을 위반하거나, 다음 각 호에 해당하는
경우 서비스 이용을 제한할 수 있습니다.
- 2년 이상 서비스를 이용한 적이 없는 경우
- 기타 정상적인 서비스 운영에 방해가 될 경우
② 상기 이용제한 규정에 따라 서비스를 이용하는 회원에게 서비스 이용에 대하여 별도 공지 없이 서비스 이용의
일시정지, 이용계약 해지 할 수 있습니다.
제 17 조 (전자우편주소 수집 금지)
회원은 전자우편주소 추출기 등을 이용하여 전자우편주소를 수집 또는 제3자에게 제공할 수 없습니다.
제 6 장 손해배상 및 기타사항
제 18 조 (손해배상)
당 사이트는 무료로 제공되는 서비스와 관련하여 회원에게 어떠한 손해가 발생하더라도 당 사이트가 고의 또는 과실로 인한 손해발생을 제외하고는 이에 대하여 책임을 부담하지 아니합니다.
제 19 조 (관할 법원)
서비스 이용으로 발생한 분쟁에 대해 소송이 제기되는 경우 민사 소송법상의 관할 법원에 제기합니다.
[부 칙]
1. (시행일) 이 약관은 2016년 9월 5일부터 적용되며, 종전 약관은 본 약관으로 대체되며, 개정된 약관의 적용일 이전 가입자도 개정된 약관의 적용을 받습니다.