• Journal of the Korean Chemical Society
• /
• v.48 no.4
• /
• pp.447-450
• /
• 2004

• Korean Journal of Microbiology
• /
• v.24 no.3
• /
• pp.204-210
• /
• 1986

One clone(pANt32) carring tRNA/sup Arg/ gene was selected from Aspergillus total tRNA gene clones. The nucleotide sequences of this tRNA gene were determined by Maxam and Gilbert's chemical cleavage methods. The sequence of this tRNA gene is as follow; 5'GGCCGGCTGCCCAATTGGCAAGGCGTCTGACTACGAATCAGGAGAT TGCAGGTTCGAGCCCTGCGTGGGTCA3'. This sequence conicides with the characteristecs of other eukaryotic tRNA. Some consensus sequences (ACT-TA bow, TATTTT and T-cluster) are found in both 5'-end and 3'-end flanking regions.

• Asian-Australasian Journal of Animal Sciences
• /
• v.16 no.1
• /
• pp.15-22
• /
• 2003

Experiments were conducted to evaluate the effect of blastomere diameters and cell cycle stages on the subsequent development of nuclear transplant rabbit embryos (NT-embryos) using nuclei derived from the 16- or 32-cell stage embryos. All blastomeres and NT-embryos were cultured individually in modified Ham's F-10 medium supplemented with 10% rabbit serum (RS) at $38^{\circ}C$ and 5% $CO_2$ in air. The diameter of blastomeres from 16-cell stage embryos was found twice of those from 32-cell stage (51 vs 27 ${\mu}m$). Significant differences were observed in cleavage rates ($\geq$3 divisions) in the isolated single blastomeres (54 vs 48 for 16-cell; 28 vs 14 for 32-cell, p<0.05), but the fusion rates of oocytes with transferred nuclei were similar between small and large single blastomeres derived from either 16-cell or 32-cell stage embryos. When 16-cell stage blastomeres were used as nuclear donors, cleavage rates ($\geq$3 divisions) of the NT-embryos were greater in the small nuclear donors than in the large donors (73 vs 55%, p<0.05). On the contrary, significantly higher cleavage (43 vs 6%, p<0.05) and developmental rates (14 vs 0%, p<0.05) were observed in the large blastomere nuclear donor group of the 32-cell stage embryos. When the cell cycle stages were controlled by a microtubule polymerization inhibitor (Demicolcine, DEM) or the combined treatment of DEM and Aphidicolin (APH), a DNA polymerase inhibitor, fusion rates were 88-96% for the 16-cell donor group (without DEM treatment), which were greater than the 32-cell donor group (54-58%). Cleavage rates were also greater in the transplants derived from G1 nuclear donor group (93-95%) than those from the DEM and APH combined treatment (73%) for the 16-cell donor group (p<0.05). No significant difference was detected in the morula/blastocyst rates in either donor cell stage (p>0.05). In conclusion, it appeared that no difference in the developmental competence between large and small isolated blastomeres was observed. When smaller 16-cell stage blastomeres were used as nuclear donor, the cleavage rate or development of NT-embryos was improved and was compromised when 32-cell stage blastomeres were used. Therefore, control nuclear stage of the donor cell at $G_1$ phase in preactivated nuclear recipients seemed to be beneficial for the cleavage rate of the reconstructed embryo in the 16-cell transplant, but not for subsequent morula or blastocyst development.

• BMB Reports
• /
• v.38 no.2
• /
• pp.191-197
• /
• 2005

Although the human genome has been nearly completely sequenced, the functions and the roles of the vast majority of the genes, and the influences of single nucleotide polymorphisms (SNPs) in these genes are not entirely known. A modified mutation detection method was developed for large-scale cloning of the possible SNPs between tumor and normal cells for facilitating the identification of genetic factors that associated with cancer formation and progression. The method involves hybridization of restriction enzyme-cut chromosomal DNA, cleavage and modification of the sites of differences by enzymes, and differential cloning of sequence variations with a designed vector. Experimental validations of the presence and location of sequence variations in the isolated clones by PCR and DNA sequencing support the capability of this method in identifying sequence differences between tumor cells and normal cells.

• Journal of Acupuncture Research
• /
• v.22 no.5
• /
• pp.91-97
• /
• 2005

This study was performed to investigate the effects of anti-cancer response of Lonicerae Flos Herbal-acupuncture. Experimental studies were evaluated through the anti-cancer response activities such as, cell viability, DNA fragmentation, and Apoptosis The results obtained were summarized as follows : 1. Lonicerae Flos Herbal-acupuncture($>300mg/m{\ell}$) could lead cancer cell to cell death. 2. Lonicerae Flos herbal-acupuncture($400mg/m{\ell}$) caused DNA cleavage. 3. Lonicerae Flos herbal-acupuncture($400mg/m{\ell}$) caused apoptosis in the cancer cell line. According to above mentioned results, Lonicerae Flos Herbal- acupunctuer is expected bo by effective for anticancer response.

• Journal of Applied Biological Chemistry
• /
• v.49 no.3
• /
• pp.86-89
• /
• 2006

The novel tetranuclear nickel (II) complex is a high rate accelerator in promoting hydrolysis of phosphate diesters. Nickel-bound bis-nitrophenyl phosphate (BNPP) can be $10^4$ times more reactive than the unbound BNPP. The large rate of enhancements by the complex slightly under basic condition has shown high catalytic activity in phosphate diester cleavage. The bell-shaped pH-rate profile indicated that the nickel-oxide form of the tetranuclear complex or its kinetic equivalent was the active species for cleaving BNPP. The catalytic hydrolysis between tetranuclear nickel (II) complex and phosphate diester proceeds via the formation of bidentate coordination of the anionic phosphate to the Ni (II) atom. This reveals that the complex has the possibility as artificial nuclease.

• YAKHAK HOEJI
• /
• v.39 no.6
• /
• pp.689-694
• /
• 1995

Sphingolipids play important roles in cell regulation and signal transduction. Recently, a sphinogomyelin cycle has been described in which activation of neutral sphingomyelinase leads to the breakdown of sphingomyelin and the generation of ceramide. Ceramide, in turn, has emerged as a candidate intracellular mediator for the action of certain cell agonists and has multiple biologic actions. Ceramide is a potent suppressor of cell growth and an inducer of apoptosis. The present studies show that exposure of IM-9 cells to ceramide resulted in internucleosomal cleavage of DNA, yielding laddered patterns of oligonucleosomal fragments characteristic of apoptosis. DNA fragmentation induced by ceramide was also confirmed by diphenylamine assay. The effect of ceramide on cell cycle progression was also studied. The addition of ceramide increase G$_{1}$ phase distribution in cell cycle. Cell cycle-related cyclin D$_{1}$ gene expression was decreased in a time-dependent manner. These results suggest that apoptosis induced by ceramide is related to cell cycle associated with the alteration of cell cycle in IM-9 cells.

• YAKHAK HOEJI
• /
• v.45 no.5
• /
• pp.484-490
• /
• 2001

Mylabris phalerata(MP) is an insect that has been used for the treatment of cancer in oriental medicine. To evaluate the anticancer activity of Mylabris phalerata, We measured the cytotoxicity of Mylabris phalerata solvent fractions such as MC, EA, BuOH and residual layers on U937, human monocytic leukemia cells. Of those fractions BuOH layer of Mylabris phalerata was the most effective with ID$_{50}$ of 140$\mu\textrm{g}$/ml. It effectively caused DNA fragmentation from the concentration of 50$\mu\textrm{g}$/ml, showed apoptotic nucleus by tenets assay and expressed apototic portion stained by Annexin-V. It also induced the activation of caspase-3 and cleavage of the substrate poly (ADP-ribose) polymerase (PARP). These results suggest BuOH layer of Mylabris phalerata exerts anticancer activity by induction of apoptosis via activation of caspase-3 protease.e.

• Clinical and Experimental Pediatrics
• /
• v.64 no.6
• /
• pp.269-279
• /
• 2021

Clustered regularly interspaced short palindromic repeats and CRISPR-associated protein 9 (CRISPR-Cas9) is an ancient prokaryotic defense system that precisely cuts foreign genomic DNA under the control of a small number of guide RNAs. The CRISPR-Cas9 system facilitates efficient double-stranded DNA cleavage that has been recently adopted for genome editing to create or correct inherited genetic mutations causing disease. Congenital heart disease (CHD) is generally caused by genetic mutations such as base substitutions, deletions, and insertions, which result in diverse developmental defects and remains a leading cause of birth defects. Pediatric CHD patients exhibit a spectrum of cardiac abnormalities such as septal defects, valvular defects, and abnormal chamber development. CHD onset occurs during the prenatal period and often results in early lethality during childhood. Because CRISPR-Cas9-based genome editing technology has gained considerable attention for its potential to prevent and treat diseases, we will review the CRISPR-Cas9 system as a genome editing tool and focus on its therapeutic application for CHD.

• Journal of Embryo Transfer
• /
• v.16 no.2
• /
• pp.73-78
• /
• 2001

This study was carried out to investigated developmental ability of IVM/IVF derived hanwoo embryos after DNA microinjection. Microinjected hanwoo embryos were cultured fur 7 days. The cleavage rates of DNA injected embrys(36.3%) was significantly lower than those of non-injected embryos(67.4%; p<0.05). The percentage of injected embryos reaching to the morulae and blastocyst was significantly lower than those of non-injected embryos(p<0.05). When injected embryo were cultured contaning L-ascorbic acid and $\alpha$-tocopherol for 168 hrs, the morulae and blastocyst rates were significantly higher than control(p<0.05). These results suggested that the addition of L-ascorbic acid and $\alpha$-tocopherol can enhanced development to the morulae and blastocyst of microinjected embryos and improved culture condition increased the transgenic hanwoo embryos.