• 미생물학회지
• /
• 제24권2호
• /
• pp.79-85
• /
• 1986

A. nidulans의 $tRNA^{Arg}$의 염기순서를 효소절단 방법으로 결정하였다. 이 방법으로 염기순서를 결정한 결과 다음과 같았다. 5'GGCCGGCUGGCCCAAXUGGCAAGGCXUCUGAXUACGAAXCAGGAGAUUGCAXXXXXGAGCXXUXXGUCGGUCACCA3'. 위의 결과로 플로버잎 구조를 만들어본 결과 안티코돈이 ACG인 $tRNA^{Arg}$으로 판명되었고. 이 결과는 아미노산 부하검사(charging test)의 결과와 일치하였다. 이 tRNA의 유천자의 염기순서 결과와 비교하여 염기순서의 정확성을 검증하였고, minor base분석을 통하여 전 염기순서를 추정하였다.

• 미생물학회지
• /
• 제24권3호
• /
• pp.204-210
• /
• 1986

One clone(pANt32) carring tRNA/sup Arg/ gene was selected from Aspergillus total tRNA gene clones. The nucleotide sequences of this tRNA gene were determined by Maxam and Gilbert's chemical cleavage methods. The sequence of this tRNA gene is as follow; 5'GGCCGGCTGCCCAATTGGCAAGGCGTCTGACTACGAATCAGGAGAT TGCAGGTTCGAGCCCTGCGTGGGTCA3'. This sequence conicides with the characteristecs of other eukaryotic tRNA. Some consensus sequences (ACT-TA bow, TATTTT and T-cluster) are found in both 5'-end and 3'-end flanking regions.

• 한국자기공명학회논문지
• /
• 제24권4호
• /
• pp.117-122
• /
• 2020

Transcription factors are proteins that bind specific sites or elements in regulatory regions of DNA, known as promoters or enhancers, where they control the transcription or expression of target genes. MEIS1 protein is a DNA-binding domain present in human transcription factors and plays important roles in various biological functions. The hydrogen exchange rate constants of the imino protons were determined for the wild-type containing the consensus DNA-binding site for the MEIS1 and those of the mutant DNA duplexes using NMR spectroscopy. The G2A-, A3G- and C4T-mutant DNA duplexes lead to clear changes in thermal stabilities of these four consensus base pairs. These unique dynamic features of the four base pairs in the consensus 5'-TGAC-3' sequence might play crucial roles in the effective DNA binding of the MEIS1 protein.

• 한국미생물·생명공학회지
• /
• 제25권1호
• /
• pp.23-29
• /
• 1997

The nucleotide sequence of the estI gene encoding acetylxylan esterase I of Bacillus stearothermophilus was determined and analyzed. The estI gene was found to consist of a 810 base pair open reading frame coding for a polypeptide of 270 amino acids with a deduced molecular weight of 30 kDa. This was in well agreement with the molecular weight (29 kDa) estimated by SDS-PAGE of the purified esterase. The coding sequence was preceded by a putative ribo some binding site 10 bp upsteam of the ATG codon. Further 53 bp upstream, the transcription initiation signals were identified. The putative $_{-}$10 sequence (TCCAAT) and $_{-}$35 seqence (TTGAAT) corresponded closely to the respective consensus sequences for the Bacillus subtiis major RNA polymerase. The G+C content of the coding region of the estI was 51% whereas that of the third position of codone was 60.2%. The N-terminal amino acid sequence of the EstI deduced from the nucleotide sequence perfectly matched the corresponding region of the purified esterase described previously. Comparison with the amino acid sequence of other esterases and lipases reported so far allowed us to identify a sequence, GLSMG at positions 123 to 127 of the EstI which was reported to be the highly conserved active site sequence for those enzymes. The nucleotide sequence of the estI revealed 55.7% homology to that of the xylC coding for the acetylxylan esterase of Caldocellum saccharolyticum.

• 미생물학회지
• /
• 제35권3호
• /
• pp.218-225
• /
• 1999

Aspergillus nidulans 의 DNA 로부터 Saccharomyces cerevisiae에서 스스로 복제가능하고, 형질전환율도 삽입벡터에 비해 10\sup 4\ 배정도 높여주는 절편을 분리한 바 있다. A. nidulans에서 ANRI 의 일부를 포함한 pILJ16-4.5는 삽입벡터인 pILJ16보다 170배 정도 높은 형질전환 효율을 보였으며, S.cerevisiae와 마찬가지로 plasmid 상태로 회수가능했다. A.nidulans 페소내에서 2-3 copy 정도로 염색체와는 별개로 존재하는 것으로 나타났으며, 재형질전환능력도 있었다. ANRI은 미토콘드리아의 DNA에서 유래한 절편으로 밝고, ARS 공통절편과 유사한 절편도 11곳에 존재한다. $\Phi$X174와 SV40 DNA에서 gyrase 가 결합하는 부위의 공통편인 YRTGNYNNY도 6곳에 존재하며, ColE1에서 gyrase가 결합하는 b site와 일치하는 절편도 하나 포함하고 있으며, ABF1 결합 부위이 공통절편과 유사한 절푠$TCN_7ACG$ 도 하나 포함하고 있다. 이를 토대로 ANRI은 A.nidulans의 형질전환 후 회수가 가능한 replicating vector 개발에 이용할 수 있다.

• Journal of Microbiology
• /
• 제44권5호
• /
• pp.515-522
• /
• 2006

A cDNA library of Ganoderma lucidum has been constructed using a Zap Express cloning vector. A glyceraldehyde-3-phosphate dehydrogenase gene (gpd) was isolated from this library by hybridization of the recombinant phage clones with a gpd-specific gene probe generated by PCR. By comparison of the cDNA and the genomic DNA sequences, it was found that the complete nucleotide sequence encodes a putative polypeptide chain of 338 amino acids interrupted by 6 introns. The predicted amino acid sequence of this gene shows a high degree of sequence similarity to the GPD proteins from yeast and filamentous fungi. The promoter region contains a CT-rich stretch, two CAAT boxes, and a consensus TATA box. The possibility of using the gpd promoter in the construction of new transformation vectors is discussed.

• Genomics & Informatics
• /
• 제1권1호
• /
• pp.55-60
• /
• 2003

The nucleotide sequence of pZMO1, a small cryptic plasmid of Zymomonas mobilis ATCC10988 was determined. Analysis of 1,680 bp of sequence revealed $69\%$ identity with Shigella sonnei plasmid, pKYM and $61\%$ identity with Nostoc sp. ss DNA replicating plasmid. Analysis of a deduced amino acid sequence of an orf of pZMO1 revealed $75\%$ identity and $90\%$ similarity with the repA gene of Synechocystis sp. plasmid pCA2.4. The upstream region of the repA gene of pZMO1 possesses six directed repeat sequences and two inverted repeat sequences at downstream of the IR consensus sequence of nick region of rolling circle replication (RCR) plasmid. A typical terminator hairpin structure was found at the downstream region of repA gene. Degradation of single-stranded plasmid DNA by S1 nuclease was detected by Southern hybridization. It suggests that pZMO1 replicates by a rolling circle mechanism in Z. mobilis ATCC10988 cells.

• 한국미생물·생명공학회지
• /
• 제25권6호
• /
• pp.560-565
• /
• 1997

DNA fragment assembly is a major concem in shot-gun DNA sequencing project. It is to reconstruct a consensus DNA sequence from a collection of random oritented fragments. We developed a computer program that is useful for DNA fragment assembly. Inputs to the program are DNA fragment sequences including IUB-IUPAC bases. The program produces the most probable reconstruction ot the original DNA sequence as a text format or a PostScript format. The program consists of four phases: the first phase quickly eliminates fragment pairs that can not possibly overlap. In the second phase, the quality of overlap between each pair is calculated to a score. In the third phase, overlap pairs are sorted by their scores and consistency of the overlaps is checked. The last phase determines consensus sequences and displays them. The performance of fragment assembly program was tested on a set of DNA fragment sequences which were generated from long DNA sequences of GenBank by a fragmentation program.

• 한국응용약물학회:학술대회논문집
• /
• 한국응용약물학회 1996년도 제4회 추계심포지움
• /
• pp.55-64
• /
• 1996

mouse chromesome2에 있는 agouti locus는 정상적으로는 털색깔을 조절하는 gene이다. mouse agouti gene은 최근에 cloning 되었고 131 amino acid peptide와 consensus signal peptide를 encode한다고 보고되었다. 이 논문에서 interspecies-DNA hybridization approach를 이용하여 mouse agouti gene의 human homologue를 cloning 하였다. Sequence analysis 결과, 이는 mouse gene에 85% 유사하였고 consensus signal peptide sequence 를 포함하는 132 amino acid를 coding하였다. somatic-cell hybrid mapping pannel과 Fluorescence-in-situ hybridization에 의한 chromosomal mapping을 한 결과, agouti gene은 MODY (maturity onset diabetes of the young), myeloid leukemia locus 등이 위치한 human chromosome 20q 11.2에 mapping 되었다. 성인 tissue로부터 추출한 RNA를 이용한 발현연구에 의하면 human agouti gene은 adipose tissue와 teatis에 발현되었다.

• Archives of Pharmacal Research
• /
• 제21권6호
• /
• pp.712-717
• /
• 1998

The complete nucleotide sequence of the cDNA clone encoding rat skeletal muscle myosin- binding protein H (MyBP-H) was determined and amino acid sequence was deduced from the nucleotide sequence (GenBank accession number AF077338). The full-length cDNA of 1782 base pairs(bp) contains a single open reading frame of 1454 bp encoding a rat MyBP-H protein of the predicted molecular mass 52.7kDa and includes the common consensus 1CA__TG' protein binding motif. The cDNA sequence of rat MyBP-H show 92%, 84% and 41% homology with those of mouse, human and chicken, respectively. The protein contains tandem internal motifs array (-FN III-Ig C2-FN III- Ig C2-) in the C-terminal region which resembles to the immunoglobulin superfamily C2 and fibronectin type III motifs. The amino acid sequence of the C-terminal Ig C2 was highly conserved among MyBPs family and other thick filament binding proteins, suggesting that the C-terminal Ig C2 might play an important role in its function. All proteins belonging to MyBP-H member contains `RKPS` sequence which is assumed to be cAMP- and cGMP-dependent protein kinase A phosphorylation site. Computer analysis of the primary sequence of rat MyBP-H predicted 11 protein kinase C (PKC)phosphorylation site, 7 casein kinase II (CK2) phosphorylation site and 4N-myristoylation site.