• Research in Plant Disease
• /
• v.6 no.1
• /
• pp.27-33
• /
• 2000

Population density of Plasmodiophora brassicae in soil of severely infested fields of Chinese cabbage decreased as soil depth increases. More than 97% of total population was found in surface soil (0-5cm depth), and a few resting spores of the pathogen were also detected in 40 cm-deep soil. the clubroot pathogen was evenly distributed over the surface soil without clustering around a Chinese cabbage plant. Density of P. brassicae in soil at 23 Chinese cabbage fields in Pyongchang, Kangwon province ranged widely from less than 10$^4$resting spores/g soil to above 10$\^$6/ resting spores/g soil. Few or none of P. brassicae was found in virgin soil without any cropping history, intermediate with 0.36-2.75$\times$10$^4$resting spores/g soil in fields of other crops but more than 10 times higher population was found in severely infected Chinese cabbage fields. Density of P. brassicae was highest in the fields of monocropping of crucifers with some exceptions, but was low in rotated fields with corn, rye, medicinal crops or other non-host vegetables. Pathoen density in soil was decreased rapidly when rye or medicinal crops were cultivated after Chinese cabbage, suggesting that survival of clubroot pathogen appears to be influenced greatly by cropping system. The improved method for detecting resting spores of P. brassicae in soil used in this study seemed to be adequate for estimating population density of P. brassicae in soil in aspects of clearer dyeing, increased detecting sensitivity, and simplicity in preparation.

• Horticultural Science & Technology
• /
• v.34 no.3
• /
• pp.433-441
• /
• 2016

Clubroot caused by the protist Plasmodiophora brassicae is one of the most destructive diseases of Brassica crops. Developing Chinese cabbage cultivars with durable clubroot resistance (CR) is an important goal of breeding programs, which will require new genetic resources to be identified and introduced. In this study, we evaluated resistance to P. brassicae race 4 using 26 Chinese cabbage (B. rapa ssp. pekinensis ) cultivars compared to the clubroot-susceptible Chinese cabbage inbred line 'BP079' and the clubroot-resistant European turnip (B. rapa ssp. rapifera ) inbred line 'IT033820'. No symptoms of clubroot disease were found in 'IT033820' infected with P. brassicae race 4, whereas the Chinese cabbage cultivars exhibited disease symptoms to various degrees. The Chinese cabbage cultivars that were reported to be clubroot-susceptible were susceptible to P. brassicae race 4; however, seven of the 20 cultivars reported to be clubroot-resistant were susceptible to this race of P. brassicae to varying degrees. Resting spores of P. brassicae were abundant within the infected root tissues of 'BP079', as revealed by light microscopy and scanning electron microscopy (SEM), but they were not detected in root tissues of 'IT033820'. Although resting spores were not detected by light microscopy in root tissues of the clubroot-resistant Chinese cabbage cultivar 'Kigokoro 75', a few spores were observed by SEM. The $F_1$ hybrids from a cross between 'IT033820' and 'BP079' showed no disease symptoms, and all $BC_1P_1$ progenies from a cross between the $F_1$ hybrid and 'IT033820' exhibited a resistance phenotype. In the $BC_1P_2$ population from a cross between the $F_1$ hybrid and 'BP079', this trait segregated at a ratio of 3(R):1(S) (${\chi}^2=1.333$, p = 0.248) at a 5% significance level. Inoculated $BC_1P_2$ plants were either highly resistant or highly susceptible to the pathogen, indicating that the CR to race 4 of P. brassicae carried by 'IT033820' is dominant. In the $F_2$ population, this trait segregated at a ratio of 15(R):1(S) (${\chi}^2=0.152$, p = 0.696) at a 5% significance level, suggesting that CR in 'IT033820' is mainly controlled by two dominant genes. Therefore, 'IT033820' represents a promising genetic resource for developing durable CR breeding lines in Chinese cabbage.

• The Korean Journal of Mycology
• /
• v.43 no.4
• /
• pp.286-289
• /
• 2015

Clubroot, caused by the obligate parasite Plasmodiophora brassicae, is a severe soilborne disease of Brassicaceae. Storage of clubroot gall is important for studies on pathogenicity and race identification. As the current storage method has been used for more than 100 years, a new storage method should be developed and the most efficient way maintaining pathogenicity should be determined. Effects of storage conditions with different storage periods on pathogenicity in galls of kimchi cabbage were examined in a greenhouse. The experiments were performed under six conditions and four temperatures in order to determine the most effective storage conditions for maintenance of pathogenicity. The most effective conditions for clubroot gall storage was the storage of whole gall at $-70^{\circ}C$ or storage of filtrate at the same temperature through eight layers of gauze after homogenization of the galls.

• Research in Plant Disease
• /
• v.20 no.1
• /
• pp.21-24
• /
• 2014

Clubroot caused by the obligate biotrophic protist Plasmodiophora brassicae Woronin is one of the most damaging diseases of Brassicaceae family. In this study, we developed species-specific primer sets for rapid and accurate detection of P. brassicae. The primer sets developed amplified a specific fragment only from P. brassicae DNA while they did not amplify a band from 10 other soilborne pathogens or from Kimchi cabbage. In sensitivity test, the species-specific primer set ITS1-1/ITS1-2 could work for approximately 10 spores/ml of genomic DNA showing more sensitivity and accuracy than previous methods. With quantitative real-time PCR test, the primer set detected less spores of P. brassicae than before, confirming that the species-specific primer set could be useful for rapid and accurate detection of P. brassicae.

• Research in Plant Disease
• /
• v.16 no.3
• /
• pp.279-284
• /
• 2010

Clubroot caused by Plasmodiophora brassicae is a widespread disease that causes serious problems in many brassica growing areas. To establish more simple and reliable clubroot screening method of Chinese cabbage to P. brassicae using soil-drenching inoculation, the development of clubroot on Chinese cabbage according to several conditions such as soil type, inoculum concentration of P. brassicae GN-1 (race 9), plant growth stage and incubation period was studied. In a commercial horticulture nursery media soil (CNS), disease severity of the seedling according to inoculum concentration increased in a dose-dependent manner, but did not in mixture of CNS and upland soil (1:1, v/v). To facilitate and acquire precise result of resistance screening of Chinese cabbage to clubroot, 10-day-old seedlings should be inoculated by drenching the spore suspension of P. brassicae to give inoculum density of $4.0{\times}10^8$ spores/pot. To develop the disease, the inoculated seedlings were incubated in a growth chamber at $20^{\circ}C$ for 3 days, and then cultivated in a greenhouse ($25{\pm}5^{\circ}C$) for five weeks. Under the optimum conditions, 25 clubroot-resistant (CR) and 3 clubroot-susceptible (CS) cultivars were tested for resistance to P. brassicae. All CR cultivars showed very clear resistance response, on the other hand all CS cultivars severly infected with the pathogen. The results suggest that this method is efficient screening method of Chinese cabbage for resistance to clubroot disease.

• The Plant Pathology Journal
• /
• v.19 no.1
• /
• pp.64-68
• /
• 2003

Cruciferous vegetable crops grown in several locations in Korea were surveyed from 1996 to 2000. Clubroot severely occurred up to a maximum of 100％ in Chinese cabbage fields in 15 out of 42 locations, and in cabbage fields in 5 out of 13 locations surveyed. The disease also severely occurred up to a maximum of 40％ in radish fields in 6 out of 35 locations, and up to a maximum of 40% and 100％ in turnip and brown mustard fields in one each out of the few locations surveyed, respectively. The disease occurred less than l％ in one kale field in one out of two locations surveyed. A total of 268 isolates of Plasmodiophora brassicae was obtained from six cruciferous vegetable crops. The isolates were classified into 13 races based on their pathogenicity to the differential varieties of cabbage and rutabaga. There were 13 races found in isolates from Chinese cabbage, while 6 races each were found in isolates from cabbage and radish. There were five and three races found in turnip and brown mustard isolates, respectively. One isolate from kale was identified as race 8. Race 8 was the most frequently isolated from five cruciferous vegetable crops, except brown mustard. Races 3 and 14 were isolated only from Chinese cabbage.

• Journal of Microbiology
• /
• v.39 no.1
• /
• pp.56-61
• /
• 2001

Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.

• Research in Plant Disease
• /
• v.17 no.2
• /
• pp.161-168
• /
• 2011

To establish simple and reliable screening method for resistant radish to Plasmodiophora brassicae Woron. using soil-drenching inoculation, the development of clubroot on radish seedlings inoculated with P. brassicae GN-1 isolate according to several conditions such as inoculum concentration, plant growth stage and incubation period after inoculation was studied. To select resistant radish against clubroot, 10-day-old seedlings were inoculated with P. brassicae by drenching the roots with the spore suspension of the pathogen to give $1{\times}10^9$ spores/pot. The inoculated seedlings were incubated in a growth chamber at $20^{\circ}C$ for 3 days then cultivated in a greenhouse ($20{\pm}5^{\circ}C$) for 6 weeks. Under the optimum conditions, 46 commercial cultivars of radish were tested for resistance to YC-1 (infecting 15 clubroot-resistant cultivars of Chinese cabbage) and GN-1 (wild type) isolates of P. brassicae. Among them, thirty-five cultivars showed resistance to both isolates and one cultivar represented susceptible response to the pathogens. On the other hand, the other cultivars showed different responses against the tested P. brassicae pathogens. The results suggest that this method is an efficient system for screening radish with resistance to clubroot.

• The Korean Journal of Pesticide Science
• /
• v.9 no.1
• /
• pp.81-87
• /
• 2005

Ethaboxam[(RS)-N-(a-cyano-2-thenyl)-4-ethyl-2-(ethylamino)-1,3-thiazole-5-carboximide] is a novel fungicide with high level of activity against Oomycetes fungi. The control effects of ethaboxam technical and various ethaboxam formulations were investigated against P. brassicae, the causal agent of clubroot disease in Chinese cabbage. When ethaboxam was applied to infested soil, club formation caused by P. brassicae was strongly inhibited at 8.33 mg/L soil and $EC_{50}$ of ethaboxam was 2.65 mg/L soil. Five ethaboxam formulations [10% suspension concentrate (SC), 15% SC, 2% granule (GR), 5% GR, 25% wettable powder] and mixture formulation of ethaboxam and metalaxyl (3%+1% GR) exhibited good efficacy against the pathogen. 10% SC, 15% SC, and 2% GR formulations of ethaboxam showed better disease controlling efficacy on Chinese cabbage clubroot than the other formulations. The $EC_{50}$ values of 10% SC, 15% SC, and 2% GR formulations of ethaboxam were 3.72 mg AI/L soil, 1.1 mg AI/L soil, and 4.95 mg AI/L soil, respectively. Among them, soil drenching application by 15% SC formulation of ethaboxam exhibited the most in vivo antifungal activity on P. brassicae. These results indicate that ethaboxam has a high potential for the control of clubroot disease.

• Research in Plant Disease
• /
• v.18 no.2
• /
• pp.86-92
• /
• 2012

Clubroot caused by Plasmodiophora brassicae Woron. is one of the most important diseases in Brassica crops worldwide. To establish more simple and reliable screening method for resistant cabbage and broccoli to P. brassicae, the development of clubroot on the plants according to inoculum concentration and incubation period after inoculating with the pathogen was investigated using P. brassicae GN1 isolate (race 9). To facilitate and acquire precise result of resistance screening of cabbage and broccoli to clubroot, 14-day-old seedlings were inoculated by drenching roots with the spore suspension of P. brassicae to give inoculum density of $2.5{\times}10^9$ spores/pot. To develop the disease, the inoculated seedlings were incubated in a growth chamber at $20^{\circ}C$ for 3 days, and then cultivated in a greenhouse ($20{\pm}5^{\circ}C$) for five weeks. Under the optimum conditions, 16 cabbage and 17 broccoli cultivars were tested for resistance to four field isolates (GN1, GN2, GS and YC) of P. brassicae collected from four regions in Korea. Among them, some cabbage and broccoli cultivars showed different resistance response to three isolates (GN1, GN2 and GS) determined as race 9 by using the differential varieties of Williams. On the other hand, all the tested cultivars were highly susceptible to YC isolate (race 2). The results suggest that this method is efficient screening method of cabbage and broccoli for resistance to P. brassicae.