• 대한핵의학회지
• /
• 제39권6호
• /
• pp.413-420
• /
• 2005

목적: 수용체 결합능 정량화를 위해서는 방사성추적자의 동태를 충분히 관찰하기 위해서 보통 뇌 PET 영상을 60-120분 정도 얻어야 한다. 이처럼 장기간 PET 영상을 얻게 되는 경우 보통 피험자의 수의적/불수의적 움직임을 피할 수 없고 이러한 피험자의 머리 움직임은 재구성된 PET 영상의 공간해상도를 저하시키고 측정된 방사능 농도의 정확성을 떨어뜨리는 요인이 된다. 이 연구에서는 동적 영상 정보만을 이용하여 피험자의 머리 움직임을 보정할 수 있는 방법을 개발하고 이를 피험자의 움직임이 불가항력적인 뇌활성화 도파민 D2 수용체 영상에 적용하여 움직임 보정이 리간드 결합능 및 외부 자극에 의한 도파민 유리(release) 정량화에 미치는 영향을 평가하였다. 대상 및 방법: 4명의 정상인 자원자에서 비디오 게임에 의한 도파민 유리를 평가하기 위한 실험으로 순간+연속 주입법을 이용하여 얻은 $[^{11}C]raclopride$ PET 영상을 이용하였으며 실제로 도파민 유리를 계산하기 위해서 필요한 프레임들만을 선별해서 영상 정합 기법을 적용하였다. 즉, $[^{11}C]raclopride$을 투여한 후 선조체에서의 리간드의 특이적 결합이 항정상태(steady state)에 최초로 도달하는 과제 수행 전 (30-50 분) 영역과, 비디오 게임 과제에 의해 도파민이 유리된 후 다시 항정상태에 도달하는 70-90분, 비디오 게임을 멈춘 후 다시 항정상태에 도달하는 110-120 분 데이터에만 움직임 보정 기법을 적용하는 방식이다. 각 항정상태 구간은 보통 2-4개의 프레임으로 구성되므로 먼저 이들 프레임들간의 영상정합을 수행(intra-condition registration)하여 평균 영상을 만들고 이들 평균 영상들을 정합하여 최종적으로 움직임 보정(inter-condition registration)을 하였다. 게임 수행 전후의 도파민유리를 평가하기 위하여 머리 움직임 보정 전후의 게임 과제 수행 전후의 결합능 백분율 변화를 구하였으며 각 조건에 대한 결합능 파라미터 영상을 구하고 움직임 보정 전후의 결합능 영상의 화소별 차이를 SPM2를 이용한 t-test(쌍체 검정)로 알아보았다. 결과: 움직임 보정 전후의 영상을 비교하였을 때, 움직임 보정 전 영상에서, 게임 수행시 영상이 게임을 위한 스크린 위치에 따른 시야 변동으로 게임 수행전 영상에 비하여 앞쪽 아래로 기울어져 있음을 알 수 있었으며 이러한 경향은 대상 피험자 모두에서 관찰되었다. 보정 전 영상으로부터 측정된 비디오 게임에 의한 도파민 유리는 putamen에서 29%, caudate head에서 57%, ventral striatum에서 17% 였으나, 보정 후 영상으로부터 구한 도파민 유리는 이들 영역에서 각각 3.9%, 14,1%, 0.6%로 움직임 보정을 하지 않은 경우 선조체 모든 구소물에서 결합능 감소, 즉 게임에 의한 도파민 유리가 과대평가됨을 알 수 있다. SPM 분석결과에서도 움직임을 보정하지 않은 영상을 이용한 경우, 선조체 구조물에서의 결합능 감소와 움직임에 의한 영상강도 저하가 복합적으로 영향을 주어 결합능 차이가 매우 유의하게 평가되었으나 움직임 보정 후 영상을 이용하여 비교한 경우, 결합능 변화가 선조체 영역에서 국한되어 나타나며 그 유의성이 움직임 보정 전에 비하여 낮음을 알 수 있었다. 결론: 뇌활성화 과제 수행시에 동반되는 피험자의 머리 움직임에 의하여 도파민 유리가 과대평가되었으며 이는 이 연구에서 제안한 영상정합을 이용한 움직임 보정기법에 의해서 개선되었다.

• Toxicological Research
• /
• 제19권3호
• /
• pp.205-210
• /
• 2003

The aim of this study was to estimate the influence of 37 bp insertion/deletion (I/O) poly-morphism of the low density lipoprotein receptor-related protein-associated protein 1 (LRPAP1) gene on anthropometrical or biochemical parameters in korean general population. To determine the frequency of the genotype, we analyzed 244 samples of Korean origin. The frequency of the I allele was 0.55 in men and 0.56 in women, which were significantly higher than the frequency (0.26) that was reported in Czech population of Caucasian origin. In addition, the I allele of this polymorphism was significantly associated with higher value of body mass index (BMI) in our subjects by ANOVA test (P<0.05), and this association was maintained after controlling for age and gender by ANCOVA test (P<0.05). Thus, our results suggest that the I/O polymorphism of the LRPAP1 gene may be useful as a genetic marker for obesity in Korean general population.

• 전산구조공학
• /
• 제1권2호
• /
• pp.131-142
• /
• 1988

유동화 콘크리트의 건조수축 및 크리프 특성을 검토하기 위하여 유동화제 2종류와 일반감수제 1종류를 사용하여 재하 하중조건(압축강도의 15% 및 30%)별, 양생조건별로 압축강도 및 건조수축을 측정하고 기건상태하의 크리프 및 크리프변형을 측정하여 유동화 콘크리트의 장기 변형특성을 검토하였다. 그 결과, 유동화 콘크리트는 보통 콘크리트에 비하여 재령 28일의 압축강도는 약 22% 증가하였고, 건조수축은 15% 감소하였으며, 크리프변형은 약 11% 감소하였고 28일간의 크리프회복은 보통 콘크리트에 비하여 작음을 알 수 있었다. 따라서 사용목적에 따른 적절한 유동화제의 선택과 적정량의 유동화제 사용은 건조수축 및 크리프변형에 효과적인 것으로 판단된다.

• 보건교육건강증진학회지
• /
• 제21권3호
• /
• pp.117-131
• /
• 2004

Purpose: This study was conducted to evaluate the health behaviors and to find out risk factors of blood pressure of adult women in a rural area. Method: The convenient sample consisted of 159 adult women who lived in G-gun. The data was collected using a self-report questionnaire for health behaviors and mercury type sphygmomanometer for BP, between Jun I and August 15, 2003. Health behaviors measured smoking, alcohol, salt, lipid, stress, exercise, coffee, BMI and medication. To accomplish the goal of study, descriptive statistics, t-test, $x^2$-test, ANOVA and multiple regression analysis were. performed with SPSS 10.0. Results: The average age of subjects was 49.2(SD7.34)years old. The average SBP and DBP of subjects were 126.22mmHg(SDl6.73) and 8 1.25mmHg(SDl 0.31). There were significant differences in smoking(p=.000), cigarette consumption(p=.001), smoking duration(p=.000), BMI(p=.033), medication (p=.001), family history(p=.000) between normotensive and hypertensive. The main risk factors on SBP were medication, age, BMI, family history and smoking duration by 35.7% of the total variance these variables explained SBP. The main risk factors on DBP were BMI, education and medication by 17.60% of the total variance these variables explained DBP. Conclusion: These results suggest that health professional have to emphasize prevention of obesity, lasting medication and no smoking for prevention and management of hypertension in community health promotion program.

• ALGAE
• /
• 제24권3호
• /
• pp.129-138
• /
• 2009

DNA-based discrimination of species is a powerful way for morphologically otherwise similar species, like centric diatoms. Here, the author sequenced long-range nuclear ribosomal DNAs, spanning from the 18S to the D5 region of the 28S rDNA, of Stephanodiscus, particularly including a Korean isolate. By comparisons, high DNA similarities were detected from the rDNAs of nine Stephanodiscus (>99.4% in 18S rDNA, >98.0% in 28S rDNA). Their genetic distances, however, were significantly different (Kruskal-Wallis test, p < 0.01) compared to two related genera, namely Cyclotella and Discostella. In addition, genetic distances of 18S rDNAs were significantly different (Student’s t-test, p = 0.000) against those of the 28S rDNAs according to individual genera (Cyclotella, Discostella, and Stephanodiscus). Phylogenetic analyses showed that Stephanodiscus and Discostella showed a sister taxon relationship, and their clade was separated from a cluster of Cyclotella (1.00 PP, 100% BP). This suggests that Stephanodiscus has highly conserved sequences of both 18S and 28S rDNA; however, Stephanodiscus is well-separated from other freshwater centric diatoms, such as Cyclotella and Discostella, at the generic level.

• 한국동물위생학회지
• /
• 제30권2호
• /
• pp.251-258
• /
• 2007

Bovine brucellosis has occurred for years in Gyeonggi province under the national test and slaughter scheme. The serum agglutination test (SAT) is a diagnostic tool to confirm the disease despite the argument on its specificity. We selected 8 farms where only one or two individuals were diagnosed as brucellosis through SAT at the primary regular herd check and isolated the causative organism and characterized the species by species-specific PCR. The pathogen isolation was successful in 6 farms out of 8 farms by microbiological culture, showing the successful rate of 75%. The isolation rate of the causative organism represents 70% from supra-mammary lymph node and 60% from uterine tissues. They were characterized as Brucella abortus biovar 1 after biotyping by PCR, showing the fragment of 498 bp. Five of 8 farms were diagnosed as brucellosis two to four times more over the intervals of two or three months. Here in this study we briefly showed the correlation of the sporadic outbreak of brucellosis tested by SAT and the isolation of the causative organism. Moreover one or two reactors against brucellosis among considerable size of herd may indicate that SAT failed to detect potentially infected individuals in the incubation stage or chronic phase of the disease.

• 대한수의학회지
• /
• 제57권1호
• /
• pp.37-42
• /
• 2017

Getah virus (GETV) infection causes sporadic outbreaks of mild febrile illness in horses and reproductive failure in pigs. In this study, we established a reverse transcription polymerase chain reaction (RT-PCR) method to detect GETV from suspected virus-infected samples. The reaction conditions were optimized and validated by using RNA extracted from GETV propagated in cell culture. A GETV-specific GED4 primer set was designed and used to amplify a 177 bp DNA fragment from a highly conserved region of the E1 glycoprotein gene in the GETV genome. RT-PCR performed with this primer set revealed high sensitivity and specificity. In the sensitivity test, the GED4 primer set detected GETV RNA at the level of $10^{2.0}\;TCID_{50}/mL$. In the specificity test, the GED4 primer set amplified only a single band of PCR product on the GETV RNA template, without non-specific amplification, and exhibited no cross-reactivity with other viral RNAs. These results suggest that this newly established RT-PCR method is useful for accurate identification of GETV infection in animals.

• Journal of Microbiology
• /
• 제39권1호
• /
• pp.56-61
• /
• 2001

Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.

• 대한용접접합학회:학술대회논문집
• /
• 대한용접접합학회 2002년도 Proceedings of the International Welding/Joining Conference-Korea
• /
• pp.295-300
• /
• 2002

In this paper, an intelligent system to determine welding parameters for each pass and welding position in pipeline welding based on one database and FEM model, two BP neural network models and a C-NN model was developed and validated. The preliminary test of the system has indicated that the developed system could determine welding parameters for pipeline welding quickly, from which good weldments can be produced without experienced welding personnel. Experiments using the predicted welding parameters from the developed system proved the feasibility of interface standards and intelligent control technology to increase productivity, improve quality, and reduce the cost of system integration.

• 한국식물병리학회지
• /
• 제14권3호
• /
• pp.223-228
• /
• 1998

Turnip mosaic virus)TuMV-Ca) was isolated from a Chinese cabbage showing severe mosaic and black necrotic spots symptoms in Korea. The virus was identified as a strain of TuMV by its host range test, particle morphology, serology, double stranded RNA analysis. For detection of the virus, reverse transcription and polymerase chain reaction(RT-PCR) was performed with a set of 18-mer TuMV-specific primers to amplify a 876 bp DNA fragment The virus was rapidly detected from total nucleic acids of virus infected tissues as well as native viral RNA of purified virion particles by RT-PCR. Detection limit of the viral RNA by RT-PCR was 10 fg.