국내 담수에서 분리된 Chlorella vulgaris PKVL7422 질소환원 유전자의 분자적 특성

Molecular Characterization of the Nitrate Reductase Gene in Chlorella vulgaris PKVL7422 Isolated from Freshwater in Korea

Abstract

Chlorella vulgaris는 인간과 동물에서 주요한 식품의 원료로 이용되는 수 조류이다. 최근 클로렐라는 어류 양식, 생물연료 및 영양물질과 치료용 단백질의 생산을 위한 이용 가능성과 관련하여 많은 관심을 받고 있다. 최근 본 연구실에서는 빠른 성장, 배양의 용이성, 암 조건에서의 배양성을 특징으로 하는 새로운 C. vulgaris PKVL7422균주를 분리하였으나, 이 균주의 질소 이용에 관련된 유전자에 대하여는 보고된 바가 없다. 본 연구에서는 cDNA 말단의 신속 증폭과 genome walking을 이용하여 C. vulgaris PKVL7422의 질산환원 효소(nitrate reductase, NR)를 동정하였다. C. vulgaris PKVL7422 NR 유전자는 약 8 kb이며, 18개의 인트론과 877개의 아미노산을 암호화 하는 19개의 엑손으로 되어 있다. 기존의 알려진 NR 단백질과의 비교 분석 결과 C. vulgaris PKVL7422 NR 단백질은 식물의 NR에 존재하는 5개의 도메인과 다수의 비변이성 아미노산 잔기를 가지고 있는 것으로 확인되었으며, 이러한 결과는 조류 NR 유전자의 분자생물학적 구조에 대한 새로운 정보를 제공한다.

Chlorella vulgaris is an important freshwater alga that is widely used as a food source by humans and animals. Recently, Chlorella has received considerable attention with regard to its potential application in aquaculture and the production of biofuels, nutrients, and therapeutic proteins. Recently, our laboratory acquired a new strain of C. vulgaris, PKVL7422, characterized by fast growth, ease of culture, and cultivability under dark conditions. However, the genes involved in its nitrogen assimilation are unknown. In this work, we identified the nitrate reductase (NR) gene of C. vulgaris PKVL7422 using rapid amplification of cDNA ends and genome walking. The NR gene of C. vulgaris PKVL7422 is approximately 8 kb long and composed of 18 introns and 19 exons, which encode 877 amino acids. An alignment analysis of the NR gene showed that it possesses the five domains and several invariant residues found in plant NRs. These results provide new insight into the molecular organization of the NR gene in algae.

Introduction

Chlorella vulgaris is a green microalga in division Chlorophyta characterized by fast growth [8] and adaptation to various culture conditions [15]; it contains numerous useful com- pounds, such as lipids and proteins. Recently, Chlorella has received considerable attention regarding its potential application in aquaculture and the production of biofuels and nu- trients, and possible utility for treating wastewater. Recently, the genome of C. vulgaris UTEX 395 was sequenced and deposited in the NCBI database [5], which enabled annotation of different C. vulgaris genes.

Higher plants, algae, bacteria, and yeast assimilate nitrate as a source of nitrogen. First, the nitrate is reduced to nitrite, which is then converted into ammonia and used as a constituent of amino acids, which are involved in protein and nucleic acid synthesis. The initial step in nitrate assimilation is catalyzed by the nitrate reductase (NR) gene, which is an NAD(P)H-dependent enzyme that plays a major role in nitrogen metabolism [4]. The NR gene has been characterized in plants, fungi, yeast, and algae. It is a complex protein containing three prosthetic groups: FAD, molybdopterin, and NADH. Its expression is controlled at different levels, including transcription and enzyme activity. The degradation and activity of NR protein are influenced by environmental factors, such as repression of nitrate reductase in the presence of ammonia; NR protein is induced by nitrate in higher plants, fungi, and green algae [9].

Recently, our laboratory acquired a new C. vulgaris strain PKVL7422 (KCTC1.331BP), which has higher homology (99.88%) to C. vulgaris based on their 18S RNA sequences. The new strain of C. vulgaris is characterized by fast growth, ease of culture, and cultivability in the dark. However, there is no information on the various genes, or their sequences, for this new strain. Therefore, this study characterized this new alga and its NR gene by constructing its full-length cDNA and analyzing its structure.

Materials and Methods

Algae culture

C. vulgaris PKVL7422 was cultured in a 250 ml flask containing 100 ml of BG-11 medium at 20℃, with a light source of 50 µmol photons m^-2 s^-1 in an orbital shaker (HB-203L, Korea) at 80 rpm. The cells were collected at the mid-log phase and flash-frozen in liquid nitrogen.

RNA extraction and cDNA construction

RNA was extracted using TRIzol reagent (Invitrogen, USA), following the manufacturer’s instructions. After ex- traction, genomic DNA was removed using the TURBO™ DNase kit (Invitrogen). The RNA concentration, and integrity thereof, were confirmed using a NanoDrop fluorometer and gel electrophoresis. The first cDNA strands were constructed using the SuperScript™ VILO™ cDNA Synthesis Kit (Invi- trogen). Primers spanning the full cDNA were designed based on the sequence predicted from our previous transcriptome study [1], and designated NR-F (ATGACAGTGCTCCTGGC AGG) and NR-R (TCAAAACTGAATGCACTGCTC TGG). The constructed cDNA was used as a template for PCR and the PCR product was purified using a gel extraction kit (GeneAll, South Korea). Then, the DNA fragments were ligated into pMD19 vector (Takara, Japan). The ligate was transformed into Escherichia coli DH5α and plated on LB- agar plates containing 100 μg/ml of ampicillin. The plasmid DNA extracted from transformed E. coli DH5α were sent for sequencing at Bionics (South Korea). Then, the BLASTp was used to analyze the deduced amino-sequence of NR gene of C. vulgaris PKVL7422 with an E-value cutoff of 10-4 against the non-redundant protein sequences of NCBI database.

The 5' and 3' ends of the NR cDNA were cloned by rapid amplification of cDNA ends (RACE) PCR, following the manufacturer’s instructions for the SMARTer RACE 5′/3′ Kit (Clontech, USA). From the cDNA sequence amplified using NR-F and NR-R, two specific primers spanning the 5' and 3' ends (NR-3GSP-F, CATTGGAGAGCTGGC AGAAGAG GGGC and NR-5GSP-R, CTCACGCGCACGCCTGTCCAG GTGGA) were designed. The PCR product was ligated into T-vector and submitted for sequencing.

Genomic DNA extraction and sequencing of the NR gene

Genomic DNA was extracted from C. vulgaris using the cetyltrimethylammonium bromide (CTAB) method [6], with some modifications. Briefly, cells were collected by centrifugation at 3,500× g for 10 min, snap frozen using liquid nitrogen, pulverized with mortar, and then transferred to warm CTAB buffer (1.5% w/v of CTAB, 1.4 M NaCl, 2 mM EDTA, 100 mM Tris HCl pH 8.0, 2% v/v β-mercaptoetha- nol). The extract was vortexed and incubated at 65℃ for 1 hr with shaking every 10 min. The genomic DNA was ex-tracted using phenol/chloroform/isoamyl alcohol (25:24:1) and precipitated using ethanol after removing contaminating RNA with RNase A. The NR gene was amplified using the primers NR-F and NR-R and subcloned into pMD19, which was sent for sequencing. The cDNA and genomic DNA sequences of the NR gene were analyzed using ClustalX [13] and the introns were identified. The amino acid sequences of the NR genes of reference organisms were retrieved from GenBank and used to construct a phylogenetic tree with the neighbor-joining method using Mega X software [7]. The domain analysis of NR protein was performed by using the SMART program (http://smart.embl-heidelberg.de/) to identify the active and other functional domains in the protein database [10].

Results

Characterization of the NR gene

The full cDNA of NR was amplified and cloned from C. vulgaris PKVL7422; it was 2,946 bp in length with an 80-bp 5' untranslated region, a 232-bp 3' untranslated region, a 2,634-bp open reading frame (ORF), and a polyadenylation signal (TGTAA) (Fig. 1). The NR ORF encodes an 877-ami- no-acid protein with a putative molecular weight of 96.0 kDa. SMART program analysis [10] showed that the NR protein contains five conserved domains, including the molybdopterin binding, dimer interface, FAD binding, NADH binding, and heme binding domains (Fig. 1). The NR gene structure was determined by cloning the NR gene from genomic DNA that was submitted for sequencing. The alignment of the cDNA sequence with the genomic sequence showed that NR possesses 19 exons with 18 introns and consists of 7,364 nucleotides (Fig. 2). The gene sequence was deposited at Gene Bank with accession number MN627215)

Fig. 1. Nucleotide and deduced amino acid sequences of NR for C. vulgaris PKVL7422. The molybdopterin binding domain is highlighted in light grey, the dimer binding domain is highlighted in dark grey, FAD binding domain is underlined, and the NADH binding domain is highlighted in green. The polyadenylation signal (TGTAA) is in bold.

Fig. 2. Genomic structure of NR gene in the genome of C. vulgaris PKVL7422. Nineteen exons and eighteen introns are shown. Each exon is represented as a black box and each intron is represented as a line.

Phylogenetic analysis and multiple sequence alignment of NR protein

The homology alignment of the deduced NR protein showed high similarity with several species of green algae, including C. vulgaris (97%), C. variabilis (80.02%), Chlamydomonas reinhardtii (55.59%), and Dunaliella salina (51.92 %). Furthermore, the phylogenetic tree analysis showed that the NR gene of C. vulgaris PKVL7422 was more closely related to the green algae NR genes than to those of higher plants (Fig. 3). The NR gene clustered with Chlamydomonas reinhardtii and was very similar to the NR gene of C. vulgaris. The alignment of the NR protein with sequences from other species showed high conservation of domains with the plant domains, including the molybdopterin binding, dimer interface, heme binding, FAD binding, and NADH binding domains (Fig. 4).

Fig. 3. Phylogenetic tree analysis based on amino acid of NR of C. vulgaris PKVL7422. The tree shows that C. vulgaris PKVL7422 NR gene belongs to the cluster of algal NRs. The Genbank accession number of all NR sequences are indicated.

Fig. 4. Alignment of amino acid of algal NRs and Arabidopsis thaliana. The arrows indicate the beginning and end of conserved domain: molybdopterin binding domain (Mo-protein), dimer binding domain (Dimer interface), Heme for heme binding domain, FAD for FAD binding domain, and NADH for NADH binding domain. The five sequences aligned were Chlamydomonas reinhardtii (XP_001696697), Volvox carteri (XP_002955156), Dunaliella salina (AAP75705), Chlorella vulgaris PKVL7422, and Arabidopsis thaliana (NP_177899).

Discussion

In this study, the full-length NR gene was cloned and sequenced using PCR amplification and primers designed from the C. vulgaris PKVL7422 transcriptome. The sequenced gene consists of 19 exons and 18 introns, with a 2,634-bp ORF that encodes an 877-amino-acid protein and contains five conserved domains: the oxidoreductase molybdopterin binding, NAD(P)H-flavin reductase, FAD binding, dimer binding, and heme binding domains. These five domains are present in the NRs of plants such as Arabidopsis thaliana [12] and algae [2]. The high number of introns (18 introns) is characteristic of algae compared with other eukaryotes [14], and might be explained by post-transcriptional processing [3]. Furthermore, a BLAST search of the NR protein showed that the oxidoreductase molybdopterin binding do-main belongs to the sulfite oxidase family; moreover, the NR protein has high homology with that of the C. vulgaris NR protein (97%) and other Chlorella (C. variabilis and C. sor- okiniana), which suggests that the deduced amino acid sequence from C. vulgaris PKVL7422 belongs to the NR family.

In the phylogenetic tree, the NR protein clustered with the green algae NR and was separated from plant NRs. Stolz and Basu [11] analyzed different eukaryotic NR genes based on their phylogenetic relationships and suggested that the NR protein originated early during evolution and divided into two main groups: fungal NR and plant and algae NR [11]. The alignment of NR protein with algal NR and plant NR (Fig. 4) shows the conservation of functional domains in algal and plant NRs.

In conclusion, the NR gene and cDNA of C. vulgaris PKVL7422 were sequenced, and its genomic structure and functional domains were characterized. This work characterized the NR gene in a new strain of C. vulgaris and should increase our understating of the nitrate assimilation mecha- nism.