DOI QR코드

DOI QR Code

북극 동물플랑크톤 Calanus glacialis TCTP (Translationally Controlled Tumor Protein)가 산화적 스트레스 상태에서 E. coli 세포의 저항성에 미치는 효과

The Effect of Translationally Controlled Tumor Protein (TCTP) of the Arctic Copepod Calanus glacialis on Protecting Escherichia coli Cells against Oxidative Stress

  • 박유경 (극지연구소 생명과학연구부) ;
  • 이창은 (극지연구소 생명과학연구부) ;
  • 이형석 (극지연구소 생명과학연구부) ;
  • 고혜연 (극지연구소 생명과학연구부) ;
  • 김소진 (서울대학교병원 & 서울대학교 의과대학 신경외과) ;
  • 이성구 (극지연구소 생명과학연구부) ;
  • 김정은 (극지연구소 생명과학연구부) ;
  • 임정한 (극지연구소 생명과학연구부) ;
  • 홍주미 (극지연구소 생명과학연구부) ;
  • 김려옥 (국립환경과학원 화학물질연구과) ;
  • 한세종 (극지연구소 생명과학연구부) ;
  • 김일찬 (극지연구소 생명과학연구부)
  • Park, Yu Kyung (Division of Life Sciences, Korea Polar Research Institute (KOPRI)) ;
  • Lee, Chang-Eun (Division of Life Sciences, Korea Polar Research Institute (KOPRI)) ;
  • Lee, Hyoungseok (Division of Life Sciences, Korea Polar Research Institute (KOPRI)) ;
  • Koh, Hye Yeon (Division of Life Sciences, Korea Polar Research Institute (KOPRI)) ;
  • Kim, Sojin (Department of Neurosurgery, Seoul National University College of Medicine, Seoul National University Hospital) ;
  • Lee, Sung Gu (Division of Life Sciences, Korea Polar Research Institute (KOPRI)) ;
  • Kim, Jung Eun (Division of Life Sciences, Korea Polar Research Institute (KOPRI)) ;
  • Yim, Joung Han (Division of Life Sciences, Korea Polar Research Institute (KOPRI)) ;
  • Hong, Ju-Mi (Division of Life Sciences, Korea Polar Research Institute (KOPRI)) ;
  • Kim, Ryeo-Ok (Chemicals Research Division, National Institute of Environmental Research) ;
  • Han, Se Jong (Division of Life Sciences, Korea Polar Research Institute (KOPRI)) ;
  • Kim, Il-Chan (Division of Life Sciences, Korea Polar Research Institute (KOPRI))
  • 투고 : 2020.04.08
  • 심사 : 2020.10.30
  • 발행 : 2020.11.30

초록

TCTP는 다양한 진핵생물에서 풍부하게 존재하는 단백질 중에 하나이며, 암, 세포 증식, 유전자 조절 등과 관련된 세포의 생리학적 기작에서 중요한 역할을 담당하는 것으로 알려져 왔다. 더구나, TCTP는 dithiothreitol (DTT)나 hydrogen peroxide (H2O2)에 의해 유도되는 산화적 스트레스에 대한 저항성에 관여하는 중요한 단백질로 주목 받아 왔다. 한편, 극지역 서식 생물들은 강한 자외선에 의해 발생한 활성산소를 조절하기 위한 다양한 항산화 방어체계를 가지고 있다. 본 연구에서는 북극 동물플랑크톤 Calanus glacialis에서 분리된 TCTP가 산화적 스트레스 하에서 E. coli 세포의 저항성에 미치는 효과를 관찰하였다. C. glacialis에서 분리된 TCTP 유전자(ORF 522 bp) 서열을 분석하였고, 약 23 kDa의 재조합 단백질을 제작하였다. 관찰 결과, TCTP 재조합 단백질이 E. coli 세포에서 과발현 되었을 때, 세포들은 H2O2에 의해 유도된 산화적 스트레스에 대한 저항성이 증가하는 것을 확인하였다. 본 관찰을 통해, 북극 C. glacialis TCTP 단백질의 항산화 조절자로서의 역할에 대한 가능성을 처음으로 제시하였다.

Translationally controlled tumor protein (TCTP) is one of the most abundant proteins in various eukaryotic organisms. TCTPs play important roles in cell physiological processes in cancer, cell proliferation, gene regulation, and heat shock response. TCTP is also considered an important factor in the resistance to oxidative stress induced by dithiothreitol or hydrogen peroxide (H2O2). Arctic calanoid copepods have a variety of antioxidant defense systems to regulate the levels of potentially harmful reactive oxygen species generated by ultraviolet radiation in the Arctic marine ecosystem. However, information on the antioxidant activity of TCTP in the Arctic Calanus glacialis is still scarce. To understand the putative antioxidant function of the Arctic copepod C. glacialis TCTP (Cg-TCTP), its gene was cloned and sequenced. The Cg-TCTP comprised 522 bp and encoded a 174-amino acid putative protein with a calculated molecular weight of ~23 kDa. The recombinant Cg-TCTP (Cg-r TCTP) gene was overexpressed in Escherichia coli (BL21), and Cg-rTCTP-transformed cells were grown in the presence or absence of H2O2. Cg-rTCTP-transformed E. coli showed increased tolerance to high H2O2 concentrations. Therefore, TCTP may be an important antioxidant protein related to tolerance of the Arctic copepod C. glacialis to oxidative stress in the harsh environment of the Arctic Ocean.

키워드

Introduction

The translationally controlled tumor protein (TCTP) is highly conserved among eukaryotes, and it was originally described as being a growth-related protein in mouse ascites and erythro-leukemic cells [4]. In several organisms, TCTPs are related to diverse cellular processes including apoptosis, microtubule organization, and ion homeostasis, and to interact with many proteins [4].

Oxidative stress is known to drive and support the aging process and the development of various diseases; therefore, there has been a growing interest on identifying genes that can protect cells from oxidative stress damaging effects. Several studies demonstrated that TCTP has important functions in cell growth and anti-apoptotic activity [6, 14, 23, 26]. In particular, upregulation of cellular TCTP levels induced by oxidative stress were found to affect the cellular protection against cell death. Indeed, TCTP upregulation induced by treatment with hydrogen peroxide (H2O2) or arsenic trioxide was observed in breast cancer [23]. However, in the case of another tumorigenic cell line (CHO-K1), H2O2 treatment did not enhanced TCTP levels [26]. Overall, the underlying mechanism of oxidative stress-promoted TCTP upregulation remains poorly understood.

Reactive oxygen species (ROS), such as H2O2, superoxide, and hydroxyl radicals, are produced in cells in the course of normal metabolism, as a result of various oxidative reactions. In vitro treatment of cells with exogenous H2O2 has been related to intracellular ROS production, with ROS accumulation inside cells triggering DNA strand breaks, the oxidation of lipids, and the decrease of intracellular antioxidants. Moreover, if the oxidative stress is low, cells may surrender to the cytotoxic effects of the accumulated ROS and die by either apoptosis or necrosis, according to the type of cell and microenvironment conditions [13, 25, 29]. Polar coastal ecosystems have been threatened by increased ultraviolet B (UV-B) radiation due to ozone depletion [24]. UV-B radiation can penetrate significant biological depths in seawater and causes biological damage by altering the DNA in the nuclei of the cells [8]. Direct UV-B exposure has been associated with physiological and biological processes in Arctic amphipods [28], northern temperate zooplankton, and ichthyoplankton [7]. UV-B has been also linked to oxidative stress, as it can induce the generation of ROS in surface waters [1] and to influence the Arctic marine ecosystem [17].

Copepod species of the genus Calanus take part in a predominant proportion of zooplankton biomass in the Arctic Ocean, and they have been proposed as useful model organisms for toxicology, genetics, and molecular biology studies[2, 19, 26]. Indeed, copepods have provided interesting insights into stress reactions in gene profiling studies [16, 21, 22]. Interestingly, in order to regulate ROS, the Arctic calanoid copepods have a variety of antioxidant defense systems. However, to date, little is known on the potential antioxidant effect of TCTP in the Arctic Calanus glacialis.

In this study, the antioxidant activity of TCTP was analyzed in Arctic copepod C. glacialis in Escherichia coli cells under stress conditions driven by H2O2. Such information may provide additional insights on the antioxidant potential of TCTP.

Materials and Methods

Sample collection

C. glacialis was collected in July 2005 from the seawater around the Korea Arctic Research Station, Dasan, in NyÅlesund, Svalbard, Norway (79°N, 12°E). Samples were homogenized in TRIzol reagent for RNA extraction. The identification of this species was conducted by partial large subunit ribosomal DNA (LSU rDNA) sequence analysis [18].

Amplification of TCTP

Total RNA was extracted using easy-BLUE Total RNA Extraction kit (Intron, Seongnam, Korea), and was dissolved in RNase-free water. The isolated RNA was stored at −80℃ until further use. To synthesize complementary DNA (cDNA), 2 μg of total RNA was used, and the cDNA was synthesized using the M-MLV Reverse Transcriptase kit (Enzynomics, Daejeon, Korea) according to the manufacturer’s instructions. For recombinant protein expression, the open reading frame (ORF) of TCTP (Cg-TCTP) was amplified by polymerase chain reaction (PCR) as per the following conditions: 35 cycles of 94℃ for 30 sec, 46℃ for 30 sec, 72℃ for 50 sec, with a final extension at 72℃ for 10 min. Primers were designed from the expressed sequence tags of C. glacialis. The nucleotide sequences of the forward and reverse PCR primers were 5'ATGAAGATCTTCAAGGATGT–3' and 5'–CTAGCACT TCTCCTCTTCAAGAC–3', respectively. The amplified fragment was purified using a PCR product purification kit (Intron, Seongnam, Korea).

Expression of and purification of recombinant CgTCTP

The PCR product was directly inserted into the pEXP5 TOPO TA vector (Invitrogen, Waltham, Massachysetts, USA), which was used to transform E. coli BL21 (DE3) cells. The cloning strategy was designed to induce the expression of TCTP from C. glacialis containing an additional C-terminal His6 tag (Cg-rTCTP). The transformants were spread onto Lauria–Bertani (LB) agar plates containing 50 μg/ml ampicillin and incubated at 37℃, and recombinant cells were cultured on LB medium containing 50 μg/ml ampicillin. Protein expression was induced as the culture optical density (OD) reached 0.7 to 0.8 by the addition of 0.5 and 1 mM isopropyl β-D-thiogalactopyranoside (IPTG). Optimal expression of Cg-rTCTP was achieved at 0.5 mM IPTG. Cg-rTCTP was directly analyzed on a 10% sodium dodecyl sulphate-polyacrylamide gel electrophoresis and stained with Coomassie brilliant blue (Bio-Rad, Hercules, California, USA). The protein samples were boiled for 10 min at 100℃ before being loaded onto the gel. Subsequently, the histidine-tagged recombinant proteins were purified using an immobilized metal affinity column chromatography (Clontech, Kusatsu, Japan) according to the manufacturer's recommendations.

Immunoblotting

Upon the gel electrophoresis, the proteins were transferred to a PVDF membrane (Millipore, Cambridge, Massachysetts, USA). Afterwards, the membrane was blocked with 5% skim milk and incubated for 2 hr at room temperature with an Anti-His6 IgG (1:500; Roche, Buonas, Switzerland), followed by a peroxidase-conjugated AffiniPure F(ab’)2 fragment anti-chicken IgG (H+L) (1:20,000; Jackson ImmunoResearch Laboratories, West Grove, Pennsylvania, USA) for additional 1 hr at room temperature. Next, the PVDF membrane was washed, and the SUPEX Western blot detection kit (Neuronex, Providence, Rhode Island, USA) was used to visualize the protein signals. The respective images were detected with a luminescent image analyzer (LAS-3000; Fujifilm, Tokyo, Japan).

H2O2 tolerance bioassay

To test the sensitivity of E. coli cells to H2O2, Cg-rTCTPtransformed bacterial cells were grown until the OD range of the culture reached 0.7-0.8. Then, the cultures were induced with IPTG at a final concentration of 0.5 mM added to the LB medium containing ampicillin. H2O2 was serially added to the induced bacterial cells, ranging from 1 to 20 mM and cultured for 12 and 24 hr. A plate culture was used to test the diluted cells (ranging from 1:1 to 1:10), with 10µl of each dilution being platted on LB agar medium containing 3 and 5 mM H2O2. Plates were then incubated at 37℃ overnight. Bacterial cells expressing the empty vector were similarly plated as controls. Growth of the bacterial cells after incubation was compared between the control and experimental groups.

Results

Sequence analysis of C. glacialis TCTP

To evaluate the TCTP sequence, its ORF was obtained from the full-length C. glacialis cDNA. The resulting ORF comprised 522 bp, encoding 173 amino acids. Based on a BLAST search using the inferred amino acid sequence, Cg-TCTP showed high similarity of sequence identity with other eukaryotic TCTP genes. Alignment of the predicted Cg-TCTP sequence with the corresponding TCTP from eight different organisms showed a high degree of preservation over long-term evolution. According to the characteristic features of TCTPs, Cg-TCTP also comprised distinctly specified TCTP-1 and TCTP-2 signature, which represent the amino acid positions 45-56 and 129-152, respectively. Alignment of the basic amino acid-rich domain sequences revealed similarities with part of the microtubule-binding domain (MTB) and calcium-binding domain (CaB). Moreover, the Cg-TCTP amino acid sequence showed 71% homology with that of Tigriopus japonicus. In addition, alignment of Cg-TCTP with TCTP homologue proteins of T. japonicus (accession AAR 88095), Brugia malay (XP_001897741), Caenorhabditis elegans (Q93573), Drosophila melanogaster (Q9VGS2), yeast (NP_594328), Arabidopsis thaliana (AAM66134), mouse (P14701), and human (NP_003286) was determined using ClustalW (Fig. 1).

1.PNG 이미지

Fig. 1. Multiple sequence alignment of various TCTPs was determined using the ClustalW software. The boxes show the TCTP-1 and TCTP-2 signature regions. Calcium-binding (CaB) and microtubule binding (MTB) regions are indicated by dark and white bars, respectively.

Expression of C. glacialis TCTP

The cDNA of C. glacialis TCTP was inserted into a eukaryotic expression vector, which was used to induce the expression of a recombinant Cg-TCTP in E. coli. Analysis of the obtained Cg-sTCTP revealed a ~23 kDa protein on SDS-PAGE (Fig. 2A, lane 3), which was detected in low amounts in both insoluble and soluble fractions of the cell extracts (Fig. 2A, lane 2). The Cg-rTCTP expression in E. coli was detected by immunoblotting using a monoclonal antibody against His-tag (Fig. 2B).

2.PNG 이미지

Fig. 2. Chromatographic purification and separation of Cg-TCTP protein. Optimal expression of Cg-rTCTP was achieved at 0.5 mM IPTG. Cg-rTCTP was directly analyzed on a 10% sodium dodecyl sulphate-polyacrylamide gel and stained with Coomassie brilliant blue. The histidine- tagged recombinant proteins were purified using an immobilized metal affinity column chromatography. A. 10% sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) results before (lane 1) and after (lane 2) induction. Recombinant Cg-TCTP protein purified on a Co-NTA column (lane 3). B. Immunoblot analysis of the recombinant protein (lane 1; control vector, lane 2; His-tagged Cg-rTCTP). The arrows indicate the TCTP recombinant protein.

Evaluation of Cg-rTCTP-transformed E. coli cells resistance to H2O2

To further confirm the antioxidant potential of Cg-rTCTP, E. coli cells expressing the recombinant protein or the empty vector alone were cultured in media containing 0-5 mM H2O2 for 24 hr. The survival rate of the cells transformed with the empty vector (control) was reduced by approximately 36-40% at 2 and 5 mM H2O2 compared with cells in the absence of H2O2, whereas Cg-rTCTP-transformed cell survival was largely unaffected by H2O2-induced toxicity (Fig. 3). In plate cultures containing 5 mM H2O2, which was a critical concentration for inhibiting cell growth, E. coli cells harboring TCTP and the empty vector did not survived (Fig. 4C). However, Cg-rTCTP-producing cells survived at a density of 1:5 in medium containing 3 mM H2O2 (Fig. 4B).

3.PNG 이미지

Fig. 3. Comparison of growth resistance to hydrogen peroxide (H2O2) between Escherichia coli transformed with pEXP5 TOPO TA vector containing C. glacialis TCTP and pEXP5 TOPO TA vector alone as control. In order to confirm the antioxidant potential of Cg-rTCTP, E. coli cells expressing the recombinant protein or the empty vector alone were cultured in media containing 0-5 mM H2O2 for 24 hr. Survival capacity of control E. coli (white box) and bacteria expressing the recombinant Cg-TCTP (black box) in the presence of difference concentrations of H2O2 for 24 hr.

4.PNG 이미지

Fig. 4. Hydrogen peroxide (H2O2) tolerance of E. coli cells transformed with Cg-rTCTP gene. Cells were serially diluted (from 1:1 to 1:10) and were plated on LB agar containing different concentrations (0 mM, 3 mM, or 5 mM) of H2O2. After incubation for 12 hr at 37℃, the growth of cells harboring the empty vector was inhibited, whereas cells expressing Cg-rTCTP showed enhanced growth up to a dilution of 1:5 in the presence of 3 mM H2O2 (B).

Additional analyses revealed that as soon as E. coli cells were exposed toH2O2, their logarithmic growth was impaired and the culture reached a stationary-like phase. When the H2O2 concentration was 3 mM, which was critical concentration for inhibiting cell growth in plate culture, the survival status of E. coli expressing Cg-rTCTP was maintained as compared with the control group (Fig. 5).

5.PNG 이미지

Fig. 5. Growth curves of control (pEXP5 TOPO TA vector control) and transformed (Cg-rTCTP) E. coli cells in LB medium containing ampicillin. A plate culture was used to test the diluted cells (ranging from 1:1 to 1:10), with 10 μl of each dilution being platted on LB agar medium containing 3 mM H2O2 for 24 hr. Bacterial cells expressing the empty vector were similarly plated as controls. Growth of the bacterial cells after incubation was compared between the control and experimental groups. Growth was monitored spectrophotometrically by following the optical density at A600 nm.

Discussion

This study is the first report on the antioxidant activity of TCTP from C. glacialis in the Arctic Ocean. Aquatic organisms are frequently exposed to environmental factors (e.g., cold, heat, and osmotic conditions) and chemical stresses (e.g., endocrine disruptor chemicals and hydrocarbons). Therefore, organisms may respond to these stresses by activating different cellular mechanisms [20], with protective reactions being described in both prokaryotes and eukaryotes[27]. To date, few studies on gene expression and stress response from marine copepods have been published, although they are known to have defense mechanisms [20]. Indeed, previous reports have identified TCTP as an antioxidant enzyme in filarial parasites [15]. TCTP was shown to exhibit an extracellular function as a histamine release factor and to hold anti-apoptotic activity [6]. In addition, the expression of TCTP was upregulated under stress conditions, such as oxidative stress, heat shock, and the presence of metals.

In the present study, a recombinant protein derived from C. glacialis TCTP was expressed in E. coli. The complete nucleotide sequence of the Cg-TCTP was 522 bp in length, and its predicted encoded protein showed high similarity to the T. japonicus (71%). TCTP is highly conserved among eukaryotic organisms. Interestingly, Cg-TCTP was found to comprise two signature regions, named TCTP 1 and TCTP 2, which are structurally similar to the Mss4/Dss4 family [30]. Moreover, it also had basic amino acid-rich regions at 45-56 and 129-152 bp, which were very similar to the MTB and CaB domains, respectively. In accordance with this finding, TCTP was previously described as a calcium-binding protein that protects cells from calcium stress-induced apoptosis [15].

Gnanasekar and Ramaswamy (2007) confirmed that presence of three cysteines located in the central portion of the protein in filarial TCTPs and suggested that these cysteine residues in recombinant TCTP from Brugia malayi were critical for its antioxidant function. However, only two cysteines were identified at 149 and 175 position of the Cg-TCTP sequence [14]. Despite of this difference, the findings herein described clearly suggest that Cg-TCTP may hold antioxidant activity. Notably, Cg-rTCTP-transformed E. coli cells survived under oxidative stress conditions. In the broth culture, Cg-rTCTP expression enabled E. coli cells to survive in the presence of 5 mM H2O2 for 24 hr (Fig. 3). However, cell growth on a plate containing 5 mM H2O2 was completely inhibited for 12 hr. When the H2O2 level was increased to 10 and 20 mM, the growth of transformed and control cells was strongly inhibited (data not shown). It has been reported that recombinant TCTP homologs survive at a maximum concentration of 1.2 mM H2O2 [14]. However, in this study, it was confirmed that Cg-rTCTP-producing cells were capable of sustaining growth at high concentrations (3 mM) of H2O2. Control cells were incubated with purified TCTP at various concentrations (0, 0.007, 0.07, and 0.7 mg), which revealed that high concentration of TCTP (0.7 mg) enhanced bacterial growth, whereas in the absence of TCTP it was inhibited (data not shown). As shown for the control condition in Fig. 5, as soon as the induced cells were exposed to H2O2, growth entered a stationary-like phase. In contrast, the growth of Cg-rTCTP-transformed cells was maintained regardless of H2O2 presence, which was similar to the growth profile of control cells not exposed to H2O2. Altogether, these results suggest that the TCTP of C. glacialis may have a protective function against H2O2-induced damage. Nevertheless, additional studies are still necessary to explore the antioxidative protective mechanisms of C. glacialis TCTP.

Over the past few years, several studies have explored the biologically relevant functions of TCTP. For example, TCTP is a known target for artemisinin and has protective functions against heat stress [3,25]. Artemisinin is a highly valuable drug used to treat malaria [11,31] and is also known to exhibit anticancer and anti-inflammatory activities[9, 10, 32, 33]. Additionally, Eichhorn et al. (2013) suggested that the antimalarial activity of artemisinin may be related to molecular interaction with TCTP [12]. Furthermore, some researchers have suggested that TCTP mRNA is downregulated in yeast cells exposed to heat shock [5], and that TCTP expression is modulated by stresses such as starvation and heat stress [6]. Contrasting to these findings, evaluation of the impact of artemisinin treatment and exposure to heat shock on the growth of Cg-rTCTP-transformed cells failed to show any significant effects (data not shown).

To confirm the antioxidant effect of Cg-TCTP, Cg-rTCTPtransformed E. coli cells were exposed to oxidative conditions using H2O2. Overall, the transformed cells showed increased tolerance against oxidative stress, indicating that overexpression of Cg-rTCTPs protect bacterial cells from oxidative damage caused by H2O2 exposure. Altogether, this study suggests that Cg-TCTP may have an important function as an antioxidant protein, and its antioxidant effect can be related to improved oxidative stress tolerance of C. glacialis in the harsh environment of the Arctic Ocean. Additional studies are still warranted to provide more information on function of TCTP in C. glacialis in the Antarctic and Arctic Oceans.

Acknowledgement

This research was supported by the research project (PE20010) of the Korea Polar Research Institute, Republic of Korea.

The Conflict of Interest Statement

The authors declare that they have no conflicts of interest with the contents of this article.

참고문헌

  1. Abele, D., Ferreyra, G. A. and Schloss, I. 1999. H2O2 accumulation from photochemical production and atmospheric wet deposition in Antarctic coastal and off-shore waters of Potter Cove, King George Island, South Shetland Islands. Antarct. Sci. 11, 131-139. https://doi.org/10.1017/s095410209900019x
  2. Ara, K., Nojima, K. and Hiromi, J. 2002. Acute toxicity of Bunker A and C refined oils to the marine harpacticoid copepod Tigriopus japonicus mori. Bull. Environ. Contam. Toxicol. 69, 104-110. https://doi.org/10.1007/s00128-002-0015-8
  3. Bhisutthibhan, J., Pan, X. Q., Hossler, P. A., Walker, D. J., Yowell, C. A., Carlton, J., Dame, J. B. and Meshnick, S. R. 1998. The Plasmodium falciparum translationally controlled tumor protein homolog and its reaction with the antimalarial drug artemisinin. J. Biol. Chem. 273, 16192-16198. https://doi.org/10.1074/jbc.273.26.16192
  4. Bohm, H., Benndorf, R., Gaestel, M., Gross, B., Nürnberg, P., Kraft, R., Otto, A. and Bielka, H. 1989. The growth-related protein P23 of the Ehrlich ascites tumor: translational control, cloning and primary structure. Biochem. Int. 19, 277-286.
  5. Bonnet, C., Perret, E., Dumont, X., Picard, A., Caput, D. and Lenaers, G. 2000. Identification and transcription control of fission yeast genes repressed by an ammonium starvation growth arrest. Yeast 16, 23-33. https://doi.org/10.1002/(SICI)1097-0061(20000115)16:1<23::AID-YEA503>3.0.CO;2-A
  6. Bommer, U. A. and Thiele, B. J. 2004. The translationally controlled tumour protein (TCTP). Int. J. Biochem. Cell. Biol. 36, 379-385. https://doi.org/10.1016/S1357-2725(03)00213-9
  7. Browman, H., Rodriguez, C. A., Beland, F., Cullen, J. J., Davis, R. F., Kouwenberg, J. H. M., Kuhn, P. S., McArthur, B., Runge, J. A., St-Pierre, J. F. and Vetter, R. D. 2000. Impact of ultraviolet radiation on marine crustacean zooplankton and ichthyoplankton: a synthesis of results from the estuary and Gulf of St. Lawrence, Canada. Mar. Ecol. Prog. Ser. 199, 293-311. https://doi.org/10.3354/meps199293
  8. Dahms, H. U. and Lee, J. S. 2010. UV radiation in marine ectotherms: molecular effects and responses. Aquat. Toxicol. 97, 3-14. https://doi.org/10.1016/j.aquatox.2009.12.002
  9. Efferth, T., Dunstan, H., Sauerbrey, A., Miyachi, H. and Chitambar, C. R. 2001. The anti-malarial artesunate is also active against cancer. Int. J. Oncol. 18, 767-773.
  10. Efferth, T., Sauerbrey, A., Olbrich, A., Gebhart, E., Rauch, P., Weber, H. O., Hengstler, J. G., Halatsch, M. E., Volm, M., Tew, K. D., Ross, D. D. and Funk, J. O. 2003. Molecular modes of action of artesunate in tumor cell lines. Mol. Pharmacol. 64, 382-394. https://doi.org/10.1124/mol.64.2.382
  11. Efferth, T. 2007. Willmar Schwabe Award 2006: Antiplasmodial and antitumor activity of artemisinin-from bench to bedside. Panta. Med. 73, 299-309. https://doi.org/10.1055/s-2007-967138
  12. Eichhorn, T., Winter, D., Büchele, B., Dirdjaja, N., Frank, M., Lehmann, W. D., Mertens, R., Krauth-Siegel, R. L., Simmet, T., Granzin, J. and Efferth, T. 2013. Molecular interaction of artemisinin with translationally controlled tumor protein (TCTP) of Plasmodium falciparum. Biochem. Pharmacol. 85, 38-45. https://doi.org/10.1016/j.bcp.2012.10.006
  13. Formichi, P., Radi, E., Battisti, C., Tarquini, E., Leonini, A., Di Stefano, A. and Federico, A. 2006. Human fibroblasts undergo oxidative stress-induced apoptosis without internucleosomal DNA fragmentation. J. Cell. Physiol. 208, 289-297. https://doi.org/10.1002/jcp.20662
  14. Gnanasekar, M. and Ramaswamy, K. 2007. Translationally controlled tumor protein of Brugia malayi functions as an antioxidant protein. Parasitol. Res. 101, 1533-1540. https://doi.org/10.1007/s00436-007-0671-z
  15. Graidist, P., Yazawa, M., Tonganunt, M., Nakatomi, A., Lin, C. C., Chang, J. Y., Phongdara, A. and Fujise, K. 2007. Fortilin binds Ca2+ and blocks Ca2+-dependent apoptosis in vivo. Biochem. J. 408, 181-191. https://doi.org/10.1042/BJ20070679
  16. Hansen, B. H., Altin, D., Rorvik, S. F., Overjordet, I. B., Olsen, A. J. and Nordtug, T. 2011. Comparative study on acute effects of water accommodated fractions of an artificially weathered crude oil on Calanus finmarchicus and Calanus glacialis (Crustacea: Copepoda). Sci. Total. Environ. 409, 704-709. https://doi.org/10.1016/j.scitotenv.2010.10.035
  17. Hader, D. P., Williamson, C. E., Wangberg, S. Å., Rautio, M., Rose, K. C., Gao, K., Helbling, E. W., Sinha, R. P. and Worrest, R. 2015. Effects of UV radiation on aquatic ecosystems and interactions with other environmental factors. Photochem. Photobiol. Sci. 14, 108-126. https://doi.org/10.1039/C4PP90035A
  18. Kim, I. C., Lee, C. E., Cho, H. H., Hong, S. G., Lee, J. S., Lee, H. S. and Lee, H. K. 2008. Molecular cloning and expression of the mitochondrial 60-kDa heat shock protein from an Arctic copepod Calanus glacialis. Genes and Genomics 30, 101-111.
  19. Kwok, K. W. and Leung, K. M. 2005. Toxicity of antifouling biocides to the intertidal harpacticoid copepod Tigriopus japonicus (Crustacea, Copepoda): effects of temperature and salinity. Mar. Pollut. Bull. 51, 830-837. https://doi.org/10.1016/j.marpolbul.2005.02.036
  20. Lauritano, C., Procaccini, G. and Ianora, A. 2012. Gene expression patterns and stress response in marine copepods. Mar. Environ. Res. 76, 22-31. https://doi.org/10.1016/j.marenvres.2011.09.015
  21. Lee, Y. M., Kim, I. C., Jung, S. O. and Lee, J. S. 2005. Analysis of 686 expressed sequence tags (ESTs) from the intertidal harpacticoid copepod Tigriopus japonicus (Crustacea, Copepoda). Mar. Pollut. Bull. 51, 757-768. https://doi.org/10.1016/j.marpolbul.2005.02.014
  22. Lee, Y. M., Park, T. J., Jung, S. O., Seo, J. S., Park, H. G., Hagiwara, A., Yoon, Y. D. and Lee, J. S. 2006. Cloning and characterization of glutathione S-transferase gene in the intertidal copepod Tigriopus japonicus and its expression after exposure to endocrine-disrupting chemicals. Mar. Environ. Res. 62, S219-223. https://doi.org/10.1016/j.marenvres.2006.04.050
  23. Lucibello, M., Gambacurta, A., Zonfrillo, M., Pierimarchi, P., Serafino, A., Rasi, G., Rubartelli, A. and Garaci, E. 2011. TCTP is a critical survival factor that protects cancer cells from oxidative stress-induced cell-death. Exp. Cell. Res. 317, 2479-2489. https://doi.org/10.1016/j.yexcr.2011.07.012
  24. Madronich, S., McKenzie, R. L., Bjorn, L. O. and Caldwell, M. M. 1998. Changes in biologically active ultraviolet radiation reaching the Earth's surface. J. Photochem. Photobiol. 46, 5-19. https://doi.org/10.1016/S1011-1344(98)00182-1
  25. Mak, C. H., Poon, M. W., Lun, H. M., Kwok, P. Y. and Ko, R. C. 2007. Heat-inducible translationally controlled tumor protein of Trichinella pseudospiralis: cloning and regulation of gene expression. Parasitol. Res. 100, 1105-1111. https://doi.org/10.1007/s00436-006-0373-y
  26. Nagano-Ito, M., Banba, A. and Ichikawa, S. 2009. Functional cloning of genes that suppress oxidative stress-induced cell death: TCTP prevents hydrogen peroxide-induced cell death. FEBS Lett. 583, 1363-1367. https://doi.org/10.1016/j.febslet.2009.03.045
  27. Nico, M., Straalen, V. and Roelofs, D. 2012. An introduction to ecological genomics. 2nd ed. Oxford University Press.
  28. Obermuller, B., Karsten, U. and Abele, D. 2005. Response of oxidative stress parameters and sunscreening compounds in Arctic amphipods during experimental exposure to maximal natural UVB radiation. J. Experiment. Mar. Bio. Eco. 323, 100-117. https://doi.org/10.1016/j.jembe.2005.03.005
  29. Saito, A., Hayashi, T., Okuno, S., Nishi, T. and Chan, P. H. 2006. Modulation of proline-rich akt substrate survival signaling pathways by oxidative stress in mouse brains after transient focal cerebral ischemia. Stroke 37, 513-517. https://doi.org/10.1161/01.str.0000198826.56611.a2
  30. Sun, J., Wu, Y., Wang, J., Ma, F., Liu, X. and Li, Q. 2008. Novel translationally controlled tumor protein homologue in the buccal gland secretion of Lampetra japonica. Biochimie 90, 1760-1768. https://doi.org/10.1016/j.biochi.2008.08.002
  31. Turschner, S. and Efferth, T. 2009. Drug resistance in Plasmodium: natural products in the fight against malaria. Mini-Rev. Med. Chem. 9, 206-214. https://doi.org/10.2174/138955709787316074
  32. Wang, Z., Qiu, J., Guo, T., B., Liu, A., Wang, Y., Li, Y. and Zhang, J. Z. 2007. Anti-inflammatory properties and regulatory mechanism of a novel derivative of artemisinin in experimental autoimmune encephalomyelitis. J. Immunol. 179, 5958-5965. https://doi.org/10.4049/jimmunol.179.9.5958
  33. Xu, H., He, Y., Yang, X., Liang, L., Zhan, Z., Ye, Y., Yang, X., Lian, F. and Sun, L. 2007. Anti-malarial agent artesunate inhibits TNF-alpha-induced production of proinflammatory cytokines via inhibition of NF-kappaB and PI3 kinase/Akt signal pathway in human rheumatoid arthritis fibroblastlike synoviocytes. Rheumatology 46, 920-926. https://doi.org/10.1093/rheumatology/kem014