생명과학회지 (Journal of Life Science)

  • 제28권11호
  • /
  • Pages.1277-1284
  • /
  • 2018
  • /
  • 1225-9918(pISSN)
  • /
  • 2287-3406(eISSN)
한국생명과학회 (Korean Society of Life Science)
권호 표지
DOI QR코드

DOI QR Code

효모염색체내에 다양한 유전자발현 cassette의 반복적 integration을 위한 system 구축

System for Repeated Integration of Various Gene Expression Cassettes in the Yeast Chromosome

  • 김연희 (동의대학교 바이오응용공학부 의생명공학전공)
  • Kim, Yeon-Hee (Biomedical Engineering and Biotechnology Major, Divison of Applied Bioengineering, Dong-Eui University)
  • 투고 : 2018.08.31
  • 심사 : 2018.10.04
  • 발행 : 2018.11.30
PDF 다운로드
⟨ 이전 논문 다음 논문 ⟩

초록

본 연구에서는 효모염색체내에 다양한 유전자 발현 cassette를 도입하기 위해 Cre/loxP system을 가진 repeated yeast integrative plasmid (R-YIp)를 구축하였다. R-YIp는 반복적으로 형질전환체를 선별할 수 있는 selective marker (CgTRP1)와 loxP 서열, 그리고 integration을 위한 목적서열을 함유하고 있어 같은 염색체의 동일한 위치에 여러 개의 유전자 발현 cassette를 도입하는 것이 가능하다. 따라서 xylan/xylose 대사에 관련된 endoxylanase (XYLP), ${\beta}$-xylosidase (XYLB), xylose reductase (GRE3) 그리고xylitol dehydrogenase (XYL2)의 효모염색체내에 도입을 시도하였다. 먼저 XYLP, XYLB, GRE3그리고 XYL2 유전자의 효율적인 발현을 위한 promoter를 선별하기 위해 pGMF-GENE과 pAMF-GENE plasmid를 구축하였고, 각 유전자들의 발현에 GAL10 promoter가 적합함을 확인하였다. 다음으로 GAL10p-GENE-GAL7t cassette를 가진 pRS-GENE plasmid (R-YIp)를 구축하여, 반복적 integration 과정과 selective marker의 제거를 통해 각각의 R-YIps를 효모 7번염색체에 순차적으로 도입하였다. R-YIp system을 통해 효모염색체내에 도입된 유전자들은 모두 안정적으로 발현되었고, 활성형의 재조합효소를 생산함을 확인할 수 있었다. 따라서 다수의 외래유전자를 효모염색체내 도입함에 있어 selective marker와 숙주세포 선택의 한계를 R-YIp system을 통해 어느 정도 극복할 수 있을 것이라 기대한다.

In this study, a repeated yeast integrative plasmid (R-YIp) harboring Cre/loxP system was constructed to integrate various gene expression cassettes into the yeast chromosome. The R-YIp system contains a reusable selective marker (CgTRP1), loxP sequence, and target sequence for integration. Therefore, many gene expression cassettes can be integrated into the same position of the same yeast chromosome. In the present study, several model enzymes involving xylan/xylose metabolism were examined, including endoxylanase (XYLP), ${\beta}$-xylosidase (XYLB), xylose reductase (GRE3) and xylitol dehydrogenase (XYL2). Efficient expression of these genes was obtained using two promoters (GAL10p and ADH1p) and various plasmids (pGMF-GENE and pAMF-GENE plasmids) were constructed. The XYLP, XYLB, GRE3, and XYL2 genes were efficiently expressed under the control of the GAL10 promoter. Subsequently, R-YIps containing the GAL10p-GENE-GAL7t cassette were constructed, resulting in pRS-XylP, pRS-XylB, pRS-Gre3, and pRS-Xyl2 plasmids. These plasmids were sequentially integrated into chromosome VII of a Saccharomyces cerevisiae strain by repeated gene integration and selective marker rescue. These genes were integrated by the R-YIp system and were stably expressed in the yeast transformants to produce active recombinant enzymes. Therefore, we expect that the R-YIp system will be able to overcome current limitations of the host cells and allow selective marker selection for the integration of various genes into the yeast chromosome.

키워드

SMGHBM_2018_v28n11_1277_f0001.png 이미지

Fig. 1. Comparison for strength of GAL10 promoter and ADH1 promoter in SEY2102△trp1/pAMF-Xylp and SEY2102△ trp1/pGMF-Xylp, SEY2102△trp1/pAMF-XylB and SEY 2102△trp1/pGMF-XylB, SEY2102△trp1/pAMF-Gre3 and SEY2102△trp1/pGMF-Gre3, SEY2102△trp1/pAMF-Xyl2 and SEY2102△trp1/pGMF-Xyl2 transformants, respectively.

SMGHBM_2018_v28n11_1277_f0002.png 이미지

Fig. 2. Schematic of the R-YIps; pRS-XylP, pRSXylB, pRS-Gre3 and pRS-Xyl2 plasmid (A) and procedure for repeated integration of foreign genes expression cassette by Cre/loxP system (B). CgTRP1 : TRP1 gene of C. glabrata, loxP : ATAACTTCGT ATAATGTATGCTATACGAAGTTAT (for sequential integration).

SMGHBM_2018_v28n11_1277_f0003.png 이미지

Fig. 3. Confirmation of integration position of each gene by PFGE and Southern hybridization. PMT6, XYLP, XYLB, GRE3 and XYL2 genes were used as probe. Lane 1; SEY2102△trp (Host strain), lane 2; 2102△trp/pRS-XylP (P), lane 3; SEY2102△ trp/pRS-XylP, pRS-XylB (PB), lane 4; SEY2102△trp/pRS-XylP, pRS-XylB, pRS-Gre3 (PBG), lane 5; SEY2102△trp/pRS-XylP, pRS-XylB, pRS-Gre3, pRS-Xyl2 (PBG2) transformant

Table 1. Plasmids list used in this study

SMGHBM_2018_v28n11_1277_t0001.png 이미지

Table 2. Oligonucleotides list used in this study

SMGHBM_2018_v28n11_1277_t0002.png 이미지

Table 3. Comparison of cell growth, endoxylanase, β-xylosidase, xylose reductase (XR) and xylitol dehydrogenase (XDH) activity in each transformant. Each transformant was cultivated in YPDG medium for 48 hr

SMGHBM_2018_v28n11_1277_t0003.png 이미지

참고문헌

  1. Bradford, M. M. 1976. Rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248-254. https://doi.org/10.1016/0003-2697(76)90527-3
  2. Chun, Y. C., Jung, K. H., Lee, J. C., Park, S. H., Chung, H. K. and Yoon, K. H. 1998. Molecular cloning and the nucleotide sequence of a Bacillus sp. KK-1 ${\beta}$-xylosidase gene. J. Microbiol. Biotechnol. 8, 28-33.
  3. Eliasson, A., Christensson, C., Wahlbom, C. F. and Hahn-Hagerdal, B. 2000. Anaerobic xylose fermentation by recombinant Saccharomyces cerevisiae carrying XYL1, XYL2, and XKS1 in mineral medium chemostat cultures. Appl. Environ. Microbiol. 66, 3381-3386. https://doi.org/10.1128/AEM.66.8.3381-3386.2000
  4. Gietz, R. D. and Schiestl, R. H. 1995. Transforming yeast with DNA. Methods Mol. Cell. Biol. 5, 225-269.
  5. Guldener, U., Heck, S., Fiedler, T., Beinhauer, J. and Hegemann, J. H. 1996. A new efficient gene disruption cassette for repeated use in budding yeast. Nucleic Acids Res. 24, 2519-2524. https://doi.org/10.1093/nar/24.13.2519
  6. Kim, M. J., Kim, B. H., Nam, S. W., Choi, E. S., Shin, D. H., Cho, H. Y., Son, K. H., Park, H. Y. and Kim, Y. H. 2013. Efficient secretory expression of recombinant endoxylanase from Bacillus sp. HY-20 in Saccharomyces cerevisiae. J. Life Sci. 23, 863-868. https://doi.org/10.5352/JLS.2013.23.7.863
  7. Kim, M. J., Nam, S. W., Tamano, K., Machida, M., Kim, S. K. and Kim, Y. H. 2011. Optimization for production of exo-${\beta}$-1,3-glucanase (laminarinase) from Aspergillus oryzae in Saccharomyces cerevisiae. Kor. J. Microbiol. Biotechnol. 26, 427-432.
  8. Kim, S. R., Kwee, N. R., Kim, B. and Jin, Y. S. 2013. Feasibility of xylose fermentation by engineered Saccharomyces cerevisiae overexpressing endogenous aldose reductase (GRE3), xylitol dehydrogenase (XYL2), and xylulose kinase (XYL3) from Scheffersomyces stipitis. FEMS. Yeast Res. 13, 312-321. https://doi.org/10.1111/1567-1364.12036
  9. Kim, Y. H., Ishikawa, D., Ha, H. P., Sugiyama, M., Kaneko, Y. and Harashima, S. 2006. Chromosome XII context is important for rDNA function in yeast. Nucleic Acids Res. 34, 2914-2924. https://doi.org/10.1093/nar/gkl293
  10. Kim, Y. H., Sugiyama, M., Yamagishi, K., Kaneko, Y., Fukui, K., Kobayashi, A. and Harashima, S. 2005. A versatile and general splitting technology for generating targeted YAC subclones. Appl. Microbiol. Biotechnol. 69, 65-70. https://doi.org/10.1007/s00253-005-1970-x
  11. Lee, F. W. and Da Silva, N. A. 1997. Sequential delta-integration for the regulated insertion of cloned genes in Saccharomyces cerevisiae. Biotechnol. Prog. 13, 368-373. https://doi.org/10.1021/bp970055d
  12. Lee, L. H., Kim, D. Y., Han, M. K., Oh, H. W., Ham, S. J., Park, D. S., Bae, K. S., Sok, D. E., Shin, D. H., Son, K. H. and Park, H. Y. 2009. Characterization of an extracellular xylanase from Bacillus sp. HY-20, a bacterium in the gut of Apis mellifera. Kor. J. Microbiol. 45, 332-338.
  13. Lim, M. Y., Lee, J. W., Lee, J. H., Kim, Y. H., Seo, J. H. and Nam, S. W. 2007. Secretory overexpression of clostridium endoglucanase A in Saccharomyces cerevisiae using GAL10 promoter and exoinulinase signal sequence. J. Life Sci. 17, 1248-1254. https://doi.org/10.5352/JLS.2007.17.9.1248
  14. Murray, A. W. and Szostak, J. W. 1983. Pedigree analysis of plasmid segregation in yeast. Cell 34, 961-970. https://doi.org/10.1016/0092-8674(83)90553-6
  15. Romanos, M. A., Scorer, C. A. and Clare, J. J. 1992. Foreign gene expression in yeast: a review. Yeast 8, 423-488. https://doi.org/10.1002/yea.320080602
  16. Sheehan, C. and Weiss, A. S. 1990. Yeast artificial chromosomes: rapid extraction for high resolution analysis. Nucleic Acids Res. 18, 2193. https://doi.org/10.1093/nar/18.8.2193
  17. Sugiyama, M., Ikushima, S., Nakazawa, T., Kaneko, Y. and Harashima, S. 2005. PCR-mediated repeated chromosome splitting in Saccharomyces cerevisiae. BioTechniques 38, 909-914. https://doi.org/10.2144/05386RR01
  18. Sugiyama, M., Nishizawa, M., Hayashi, K., Kaneko, Y., Fukui, K., Kobayashi, A. and Harashima, S. 2003. Repeated chromosome splitting targeted to delta sequences in Saccharomyces cerevisiae. J. Biosci. Bioeng. 96, 397-400. https://doi.org/10.1016/S1389-1723(03)90144-7
  19. Zhang, J., Tian, S., Zhang, Y. and Yang, X. 2008. Construction of a recombinant S. cerevisiae expressing a fusion protein and study on the effect of converting xylose and glucose to ethanol. Appl. Biochem. Biotechnol. 150, 185-192. https://doi.org/10.1007/s12010-008-8203-6