Introduction
Rice (Oryza sativa L.) is one of the world’s most important food crops, feeding about half of all people worldwide. Bacterial leaf blight caused by Xanthomonas oryzae pv. oryzae (Xoo) is one of the most widespread and destructive rice diseases, resulting in an annual yield loss of up to 60% [25]. Currently, the rice disease is managed by the use of resistant cultivars and systemic bactericides. However, the lack of durable resistance, the existence of pathogenic variability, and concerns regarding chemical resistance have limited the potential of such strategies for the disease management [7,15]. Thus, more efficient and environment-friendly biopesticides are urgently needed for control of the rice disease.
Many Bacillus species are considered antagonistic microorganisms owing to their potential to produce structurally diverse antimicrobial compounds [20]. Among the diverse biologically active molecules synthesized by Bacillus, lipopeptides classified into three different families (surfactins, iturins, and fengycins) are of particular interest in the context of biocontrol. Bacillus lipopeptides exhibit successful biocontrol effects not only by inhibiting pathogen growth, but also by re-inforcing the host resistance potential through the induction of plant defense responses [21].
The antimicrobial activity of Bacillus lipopeptides is more commonly described against fungal pathogens [6,18,21]. In contrast to the numerous studies of the antifungal action of Bacillus lipopeptides, few studies have reported their antibacterial action, especially against Xoo. Furthermore, the majority of the studies on antibacterial effects of Bacillus lipopeptides focus on their activity spectrum, and the best-studied mechanism regarding antibacterial action of Bacillus lipopeptides is the disruption of membrane integrity [4,19,30]. The ability of Bacillus lipopeptides to induce plant defense responses upon pathogen attack has been extensively examined and confirmed for a wide variety of plants, including tomato [5], grapevine [11], perennial ryegrass [22], strawberry [28], citrus [24], and Beta vulgaris [10]. However, most such studies are conducted in plant-fungal pathogen systems.
Bacillus amyloliquefaciens B014 is a bacterial endophyte previously isolated from healthy Anthurium tissue by our group. Our previous studies have shown that B. amyloliquefaciens B014 has the potential to coproduce lipopeptide iturins and surfactins [17]. Considering the economic importance of rice bacterial leaf blight caused by Xoo, the goal of this study was to investigate the in vitro antibiosis action of a lipopeptide obtained from B. amyloliquefaciens B014 against Xoo and the ability of the Bacillus lipopeptide to trigger rice-induced resistance to Xoo infection and to evaluate and characterize its biocontrol potential and mechanisms.
Materials and Methods
Bacterial Strains and Culture Condition
Xoo 102, a virulent strain of Xanthomonas oryzae pv. oryzae, was originally isolated from rice (Oryza sativa L.) leaf exhibiting typical symptoms of bacterial blight by our laboratory. Purified Xoo 102 was subcultured on nutrient agar (NA) at 30℃ for routine use and stored at -80℃ for long-term storage. For the preparation of pathogen inoculums, Xoo 102 was inoculated into an NA slant and incubated at 30℃ for 24 h. At that time, the cells on the surface of the slant were collected by washing with sterile ddH2O and diluted to OD600 = 0.1 (approximately 108 CFU/ml). The antagonist bacterium B. amyloliquefaciens B014 was isolated from internal tissue of a healthy Anthurium plant [17]. The storage and cell maintenance conditions were the same as described for Xoo 102.
Extraction and Purification of Antibacterial Lipopeptides from B. amyloliquefaciens B014
Lipopeptides were extracted from the culture supernatant of B. amyloliquefaciens B014 according the methods described by Kim et al. [16] with some modification. In brief, strain B014 was incubated in nutrient broth (NB) broth with shaking (150 rpm) for 38 h at 30℃. The bacterial cells were removed from the lipopeptide-containing culture of strain B014 by centrifugation at 10,000 ×g for 20 min. The resulting supernatant was acidified to pH 2.0 with concentrated HCl and the suspension was incubated in a refrigerator overnight to facilitate precipitation of lipopeptides. The acid precipitate was collected by centrifugation at 10,000 ×g for 15 min at 25℃ and was redissolved in ddH2O to obtained crude water-soluble lipopeptide. After adjustment to pH 7.0 with 1.0 N NaOH, the water-soluble lipopeptide was heated in a water bath of 90℃ for 30 min to remove the heat-unstable component in the lipopeptide extract.
To obtain anti-Xoo lipopeptides, the crude water-soluble lipopeptide extract was applied to a column (300 × 26 mm) of DEAE-cellulose (Sigma, USA) and eluted successively with 0.5 M NaCl solutions, at a flow rate of 1.0 ml/min. The products were monitored by absorbance at 215 nm. Fractions were pooled and concentrated with a rotary evaporator, and then antagonistic activity against Xoo 102 was tested according to previously described methods [17]. The fractions exhibiting anti-Xoo activity were merged and dialyzed overnight against deionized water and then concentrated under reduced pressure at 60℃. The final lipopeptide obtained was named AXLP14.
MALDI-TOF Mass Spectrometry Analysis of Lipopeptide AXLP14
The chemical composition of the obtained lipopeptide AXLP14 was analyzed using a matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry performed using a Voyager DE-STR MALDI-TOF instrument (Applied Biosystems, USA) according the methods described by Kim et al. [16]. In brief, a 0.5 μl volume of AXLP14 (0.1 mg/ml) was mixed with an equal volume of 0.1% solution of α-cyano-4-hydroxycinnamic acid in acetonitrile-water-TFA (50:50:0.1 (v/v/v)) used as the matrix. The mixture was then spotted (1 μl) on the target plate and allowed to air dry. The instrument was operated in reflection-positive ion mode at an accelerating voltage of 28 kV. The N2 laser was operated at the minimum threshold level required to generate a signal and minimize dissociation. A surfactin standard (Sigma, USA) composed of C13 to C15 surfactin homologues was also analyzed under the same conditions.
Evaluation of the Antibacterial Activity of AXLP14 against Xoo 102
The antagonistic activity against Xoo 102 growth was evaluated by the filter paper disc method as previously described [17]. The minimum inhibition concentration (MIC) and the minimum bactericidal concentration (MBC) of AXLP14 against Xoo 102 were determined by the 2-fold microbroth dilution method devised by Andrews [1]. The assay was performed at least in triplicates. To examine whether AXLP14 exhibits bacteriolytic activity against Xoo 102, a Xoo 102 cell suspension was mixed with AXLP14 at a final concentration higher than the MBC and then incubated at 30℃ for 2 h. After incubation, a drop of Xoo 102 cell suspension was mounted on a glass cover slip and fixed with 2.5% glutaraldehyde for 24 h. After being serially dehydrated in a graded series of alcohol (50%, 70%, 80%, 90%, 95%, and 100% (v/v)), the samples were dried in a criticalpoint drier, coated with gold-palladium, and viewed with a scanning electron microscope (SEM; Zeiss Gemini Ultra-55, Germany).
Evaluation of the Effect of AXLP14 on Xoo 102 Biofilm Formation
Xoo 102 biofilm was grown on glass coverslips as described by Banas et al. [2]. Briefly, a 10 μl volume of Xoo 102 cell suspension was inoculated into NB (1 ml) with the addition of AXLP14 at a final concentration of 0.613 mg/ml (1/2 MIC) or without (as control) in an 8-well microtiter plate. A sterile glass slide was placed into every well prior to the broth being added. Then, the final plate was incubated at 30℃. Five days after incubation, the glass coverslips with Xoo 102 cultures were washed three times with a phosphate buffer (pH 7.2) and Xoo 102 biofilm formation was observed by SEM as described above.
Evaluation of the Effect of AXLP14 on Xoo 102 Swimming
A 3 μl volume of Xoo 102 cell suspension was carefully placed onto the center of soft NA plates (0.5% agar) with the addition of AXLP14 at a final concentration less than the MIC (0.154, 0.307, and 0.613 mg/ml or 0 mg/ml). The final plates were then incubated at 30℃ and were evaluated after 5 days by measuring the expanding diameter of Xoo 102 lawn [12]. The assay was performed at least in triplicates.
Evaluation of the Biocontrol Effect of AXLP14 on Xoo 102-Induced Rice Disease
The Japonica rice variety Zhonghua 11 was used in this study. The rice seeds were germinated for 3 days at room temperature. The seedlings were then planted in 15-cm-diameter pots containing sterile moist soil (clay: sand, 3:1) dipped in 1/2-diluted Hoagland micronutrients. The planted seedlings were kept in a greenhouse at 26 ± 2℃ with a relative humidity of 80 ± 5% for another 15 days. After the 15 days, the seedlings were challenged by inoculation with freshly prepared cell suspensions of Xoo 102 using the standard leaf clipping method [14]. One day after inoculation, the seedlings were uniformly sprayed with a 1 ml volume of AXLP14 (10.0, 5.0, and 2.5 mg/ml) or sterile ddH2O (as a pathogen inoculation control) on the leaf surface of every seedling. The seedlings were then returned to greenhouse conditions for disease development. At day 15 after pathogen challenge, the number of leaves exhibiting disease symptoms and the lesion size (lesion length/leaf length) were recorded. For each treatment, 30 seedlings were used, and the assay was repeated at least three times in independent experiments.
Detection of Expression of Rice Defense-Related Genes
Rice seedlings at the three-leaf stage were challenge inoculated with Xoo 102 and were then treated with AXLP14 (5 mg/ml) as described above or treated with sterile ddH2O (as a only pathogen inoculated control). Rice seedlings inoculated with sterile ddH2O and then treated with ddH2O were included as a non-inoculated control. Every 24 h after inoculation, the expression of four well-characterized rice defense-related genes (OsNDPR1, OsWRKY45, OsLip9, and OsNCED3) in the seedlings were examined by RT-PCR using gene-specific primers as follows (5’-3’) [25]: CACGCCTAAGCCTCGGATTA (forward) and TCAGTGAGCAGCATCCTGACTAG (reverse) for OsNPR1; GGACGCAGCAATCGTCCGGG (forward) and CGGAAGTAGGCCTTTGGGTGC (reverse) for OsWRKY45; TACGGCTTCCACGGCACGTTC (forward) and TGCCAGATTGCCAGCCCGTC (reverse) for OsNECD3; and CGGCGGCCTCTTCGAGACAAC (forward) and CGGAAGTAGGCCTTTGGGTGC (reverse) for OsLip9. For RT-PCR analysis, total RNAs were extracted from the rice leaf samples next to the sites of bacterial infection using the RNeasy Plant Mini kit with DNAase (Qiagen) according to the manufacturer’s instructions. The concentration and quality of total RNA were examined using a UVmini-1240 spectrophotometer (Shimadzu, Japan). cDNA was synthesized with a two-step RT-PCR kit (Takara) from 2 μg of extracted RNA according to the product manual. The resultant cDNA was used for PCR. Quantitative RT-PCR amplifications were conducted in optical 96-well plates using the Mx3005P real-time PCR detection system (Stratagene) with SYBR Green master mix to monitor dsDNA synthesis. The thermal profile used consisted of an initial denaturation step at 95℃ for 8 min, followed by 35 cycles of 95℃ for 30 sec, 59℃ for 30 sec, and 72℃ for 1 min. Control PCR amplifications involved the use of RNA as a template to verify the elimination of contaminated DNA. The specificity of each primer for the target gene was confirmed by sequencing of the PCR products. The amount of plant RNA in each sample was normalized using OsActin as an internal control. For each assay, RT-PCR was performed three times with three independently isolated batches of total RNA. The primer pair for OsActin PCR was 5’-TCCATCTTGGCATCTCTCAG-3’ (forward) and 5’-GTACCCGCATCAGGCATCTG-3’ (reverse) [13].
Results
MALDI-TOF Mass Spectrometry Analysis of Lipopeptide AXLP14
A semi-purified lipopeptide (named AXLP14) was obtained from the culture supernatant of B. amyloliquefaciens B014 by virtue of antagonistic activity against Xoo 102, a virulent isolate of Xoo. The MALDI-TOF mass spectrometry profile for AXLP14 revealed three main mass peaks at 1046.8, 1060.8, and 1074.6 (Fig. 1), which are specific for surfactin-like lipopeptides [24]. Those peaks detected in the MALDI-TOF profile of AXLP14 were also seen in the MALDI-TOF profile of a surfactin standard composed of C13 to C15 surfactin homologs (Fig. 1A). The results indicated that lipopeptide AXLP14 consists of surfactin homologs.
Fig. 1.MALDI-TOF mass spectra profiles of lipopeptide AXLP14 from Bacillus amyloliquefaciens B014. The same surfactin-specific mass peaks at m/z = 1046.8, 1060.8, and 1074.6 detected in the mass spectra profiles of both AXLP14 and surfactin standard (A) indicate lipopeptide AXLP14 consisted of surfactin homologs.
Evaluation of the Antibacterial Activity of AXLP14 against Xoo 102
Lipopeptide AXLP14 displayed a strong inhibition against Xoo 102 growth at relative low concentrations, as revealed by the presence of close inhibition zones around the AXLP14-containing paper discs in a diffusion test (Fig. 2A). The diameters of the inhibition zones increased with increasing AXLP14 concentration, indicating the concentration-dependent inhibition of Xoo 102 growth by AXLP14. The MIC and MBC of AXLP14 against Xoo 102 were determined by the microbroth dilution method to be 1.25 and 2.5 mg/ml, respectively. At concentrations higher than the MBC, AXLP14 had bacteriolytic activity against Xoo 102 (Fig. 2B).
Fig. 2.The in vitro growth inhibition of lipopeptide AXLP14 (A) and bacteriolytic activity against Xoo 102 (B). 1, 2, 3, and 4 indicate a-10 μl volume of AXLP14 at the concentrations of 2.5, 5.0, 10.0, and 20.0 mg/ml, respectively, was added to the each paper disc. Bacteriolytic activity was observed 2 h after incubation in NB with AXLP14 (5.0 mg/ml) by scanning electron microscope.
Evaluation of the Effect of AXLP14 on Xoo 102 Biofilm Formation
Xoo 102 cells grown on the glass coverslip with conventional NB were interconnected and encased in a scaffolding network composed of extracellular matrix, suggesting a three-dimensional architecture of biofilm formation (Fig. 3A). Under the same growth conditions but in the presence of AXLP14 at a concentration of less than the MIC (0.613 mg/ml), Xoo 102 cells were individually scattered over the surface rather than in any arrangement (Fig. 3B), indicating that AXLP14 strongly inhibits Xoo 102 biofilm formation.
Fig. 3.Effect of AXLP14 on the biofilm formation of Xoo 102. Biofilm formation was observed by scanning electron microscopy 5 days after incubation in NB with AXLP14 at the final concentration of 0.613 mg/ml (B), or without (A).
Evaluation of the Effect of AXLP14 on Xoo 102 Swimming
The average lawn diameters of Xoo 102 incubated on an NA plate with AXLP14 at the final concentrations of 0.613, 0.307, and 0.154 mg/ml decreased by 44.5%, 31.9%, and 21.8%, respectively, compared with those incubated on a control plate without AXLP14 (Fig. 4). Thus, AXLP14 exerts concentration-dependent inhibition of Xoo 102 swimming.
Fig. 4.Effect of AXLP14 on Xoo 102 swimming. The lawn diameter of Xoo 102 was measured 5 days after incubation at 30℃ on an NA plate with AXLP14 at the final concentrations of 0.613, 0.307, and 0.154 mg/ml, or without (0, as control), respectively. Data are the mean ± SD of three repeat tests for each test. Values in each bar with different letters mean significant difference (p < 0.05).
Evaluation of AXLP14-Induced Suppression of Rice Disease Caused by Xoo 102
Under the conditions tested in this study, 15 days after challenge with the pathogen Xoo 102, >85% of rice seedling leaves inoculated with Xoo 102 developed foliar symptoms of rice bacterial blight disease, and the average lesion size was greater than 85%. The leaves of these rice seedlings were also obviously wilted and rolled, indicating that Xoo 102 is the virulent causal agent of rice bacterial blight disease. However, in rice seedlings treated with 2.0, 5.0, or 10.0 mg/ml of AXLP14, 15 days after inoculation with Xoo 102, only 45.11%, 22.10%, and 6.67%, respectively, of the leaves of inoculated seedlings developed the symptoms of rice bacterial blight disease (Fig. 5). The lesion sizes in the seedlings treated with 2.5, 5.0, or 10.0 mg/ml of AXLP14 were 40.93%, 20.56%, and 4.13%, respectively. These percentages were significantly lower than those of the control rice seedlings challenged with only the pathogen (Fig. 5). These results indicated that AXLP14 effectively protects against rice disease caused by Xoo 102 under the tested concentrations.
Fig. 5.AXLP14-induced suppression of rice disease caused by Xoo 102. Data were recorded 15 days after inoculation with Xoo 102 and are reported as the mean ± SD of three repeated experiments. Each experiment was conducted with at least 30 seedlings in each group and the assay was repeated at least three times in independent experiments. Values in each band with different letters mean significant difference (p < 0.05).
Detection of Expression of Rice Defense-Related Genes
Fig. 6 shows changes in the expression of four defense-related genes (OsNDPR1, OsWRKY45, OsNCED3, and OsLip9) in rice seedlings inoculated with Xoo 102 followed by treatment with AXLP14, non-inoculated control seedlings, and seedlings not treated with AXLP14. The expression of OsNDPR1 in AXLP14-treated and untreated rice seedlings increased and peaked at day 2 after inoculation with Xoo 102. However, the peak expression of OsNDPR1 in rice seedlings treated with AXLP14 was approximately 2.3 times higher than that of rice seedlings inoculated with only Xoo 102. After its peak, OsNDPR1 remained at more than 86% of its peak expression level in AXLP14-treated rice seedlings. In rice seedlings inoculated with only Xoo 102, however, the expression of OsNDPR1 decreased rapidly to a level lower than that detected in non-inoculated control seedlings. OsWRKY45 showed a similar trend in expression in those seedlings, peaking in rice seedlings inoculated with Xoo 102 followed by treatment with AXLP14 at 4.2 times higher than the level observed in rice seedlings inoculated with only Xoo 102.
Fig. 6.Detection of expression of rice defense-related genes. Gene expression was analyzed at days 0, 1, 2, 3, 4, and 5 after inoculation with Xoo 102. AXLP14 treatment was done by spraying a 1 ml volume of AXLP14 (5 mg/ml) onto the leaves of each seedling 12 h after inoculation with Xoo 102. Data are reported as the mean ± SD of three repeat tests.
The changes in expression of genes OsNCED3 and OsLip9 in those rice seedlings also displayed the same tendency but were largely different from those of OsNDPR1 and OsWRKY45 (Fig. 6). In rice seedlings only inoculated with Xoo 102, the expression of OsNCED3 and OsLip9 remained static at early time points but increased steadily from day 2 after inoculation with Xoo 102 up to the end of the test period. At the time point, the expression of OsNCED3 and OsLip9 was approximately 18 and 12 times the levels found in non-inoculated control seedlings, respectively, indicating a strong induction of Xoo 102 on the expression of OsNCED3 and OsLip9 of rice seedlings. However, in rice seedlings treated with AXLP14 after inoculation with Xoo 102, the expression of both OsNCED3 and OsLip9 remained at the levels close to that detected in non-inoculated control seedlings at all tested time points (Fig. 6). Those results indicated that AXLP14 can effectively inhibit the Xoo 102-induced expression of OsNCED3 and OsLip9 genes in rice seedlings.
Discussion
This direct antagonism of pathogen growth is the most powerful mechanism of a biocontrol agent as it usually provides the initial and the most rapid means of limiting the growth of a plant pathogen. In the present study, a lipopeptide named AXLP14 was obtained from the culture supernatant of B. amyloliquefaciens strain B014 and displayed concentration-dependent antibacterial, bactericidal, and bacteriolytic effects (Fig. 2). MALDI-TOF MS analysis demonstrated that AXLP14 is a surfactin homolog (Fig. 1), consistent with our previous investigation showing that B. amyloliquefaciens B014 produces surfactin-like lipopeptides [17]. Our present results were also consistent with several previous studies addressing surfactins as the major Bacillus metabolites involved in antagonism of bacterial pathogens [26,31].
Swimming and biofilm formation play critical roles in facilitating adhesion of bacteria to the host surface during the initial stages of plant-pathogen interactions and disease development [27]. Our present results clearly show that the lipopeptide AXLP14 reduced swimming of pathogenic Xoo 102 in a concentration-dependent manner (Fig. 4), and also strongly inhibited Xoo 102 biofilm formation at a concentration less than the MIC (Fig. 3). The in situ production of lipopeptides by Bacillus sp. in soil- and plantassociated environments is very low [21]. The inhibitory effect of low-concentration AXLP14 on the virulence factors of Xoo is a notable trait for AXLP14 and its producer as a control agent to control rice disease caused by Xoo.
Plant-induced resistance has been recognized as the most attractive type of biocontrol agent for plant disease management in modern agriculture because it could provide plants with long-lasting protection from pathogens [5,8,29]. Furthermore, the ability of AXLP14 to trigger rice-induced resistance to Xoo attack was investigated by assessing the expression of several well-studied genes related to rice defense against Xoo in rice seedlings treated with AXLP14 during the progression of Xoo infection. The phytohormone salicylic acid (SA)-dependent pathway plays a vital role in rice resistance to Xoo [9,23]. OsNPR1 is a key positive regulator of SA-mediated rice immunity, and its ectopic expression in rice conferred high levels of resistance to Xoo [9]. OsWRKY45 is a key transcription factor in the branched SA pathway. Similar to OsNPR1, rice plants overexpressing OsWRKY45 are extremely resistant to Xoo [23]. Our present gene expression analysis showed that AXLP14 strongly and continuously up-regulated the expression of both OsNPR1 and OsWRKY45 in Xoo-infected rice seedlings (Fig. 6), suggesting AXLP14 may effectively trigger SA-mediated rice immunity and may therefore contribute to resistance to Xoo.
Abscisic acid (ABA) has been studied as an abiotic stress hormone. ABA has also recently emerged as a pivotal determinant in the outcome of plant-pathogen interactions. In some interactions, ABA enhances plant basal defense by priming for callose deposition and stomatal closure, and thereby positively influences disease outcomes [25,27]. In most cases, however, ABA is reported to act as a pathogenic susceptibility-enhancing hormone or repressive hormones of plant immunity. In rice, application of exogenous ABA compromises rice resistance to Xoo, whereas the inhibition of ABA biosynthesis, degradation of ABA, and blocking of ABA signaling enhance rice resistance to Magnaporthe oryzae and Xoo [25,27]. ABA also cross-communicates with bacterial QS systems, which could contribute to Xoo virulence in rice [27]. On the other hand, Xoo may dramatically increase the ABA biosynthesis and signaling of the host plant in order to cause disease [26]. OsNCED3 encodes a key enzyme in the rice ABA biosynthesis pathway [3] and OsLip9 is an ABA signaling-responsive gene of rice [25]. In the present study, consistent with the previous results [25], Xoo 102 induced a continuously high level of both OsNCED3 and OsLip9 expression in Xoo 102-infected rice seedlings. However, in Xoo 102-infected rice seedlings treated with AXLP14, the expression levels of both OsNCED3 and OsLip9 showed no large difference to those detected in non-inoculated control seedlings (Fig. 6). Such results indicate that AXLP14 may effectively inhibit the ABA biosynthesis and signaling of rice seedlings induced by Xoo 102, and consequently may reduce Xoo virulence to the rice plant and contribute to the resistance of rice against Xoo. The ability of Bacillus lipopeptides to trigger classical SA and JA/ET signal pathways to enhance plant defense upon pathogen attack has been extensively examined and confirmed in the plant-pathogen interaction [5,10,11,22,24,28]. However, our present study, for the first time, addressed the antagonistic effect of Bacillus lipopeptide on repressive hormones involved in plant immunity.
In the present study, applying AXLP14 to rice seedlings significantly reduced the incidence and severity of disease caused by Xoo when compared with that of rice seedlings only challenged by the pathogen (Fig. 5). This result was consistent with the fact that AXLP14 possesses multi-layered biocontrol-related traits, as descried above. However, the present disease suppression test was performed only on a small scale and under indoor controlled conditions. Future studies will require a larger sample size and should be performed under field conditions to facilitate the application of AXLP14 as a biocontrol agent.
In conclusion, lipopeptide AXLP14 from Bacillus amyloliquefaciens B014 not only strongly inhibited the growth of Xoo but also negatively affected the virulence traits of Xoo, including motility and biofilm formation. In addition to its multilayered antibiosis actions against Xoo, AXLP14 was capable of protecting rice against Xoo-induced disease by re-inforcing SA defense signaling and by interfering with the ABA-based virulence of the pathogen. These results highlight the potential of AXLP14 and its producer as biopesticides to control rice diseases caused by Xoo. These results also improve our understanding of the biocontrol mechanism of Bacillus spp.
참고문헌
- Andrews JM. 2011. Determination of minimum inhibitory concentrations. J. Antimicrob. Chemother. 48: 5-16. https://doi.org/10.1093/jac/48.suppl_1.5
- Banas J, Hazlett KRO, Mazurkiewicz JE. 2001. An in vitro model for studying the contributions of the Streptococcus mutans glucan-binding protein-A to biofilm structure. Methods Enzymol. 337: 425-433.
- Bang SWI, Park SH, Jeong JS, Kim YS, Jung H, Ha SH, Kim JK. 2013. Characterization of the stress-inducible OsNCED3 promoter in different transgenic rice organs and over three homozygous generations. Planta 237: 211-224. https://doi.org/10.1007/s00425-012-1764-1
- Bionda N, Fleeman RM, Shaw LN, Cudic P. 2013. Effect of ester to amide or N-methyl amide substitution on bacterial membrane depolarization and antibacterial activity of novel cyclic lipopeptides. Chem. Med. Chem. 8: 1394-1402. https://doi.org/10.1002/cmdc.201300173
- Cawoy H, Mariutto M, Guillaume H, Fisher C, Vasilyeva N, Thonart P, et al. 2014. Plant defense stimulation by natural isolates of Bacillus depends on efficient surfactin production. Mol. Plant Microbe Interact. 27: 87-100. https://doi.org/10.1094/MPMI-09-13-0262-R
- Cawoy H, Debois D, Franzil L, Edwin DP, Thonart P, Ongena M. 2015. Lipopeptides as main ingredients for inhibition of fungal phytopathogens by Bacillus subtilis/amyloliquefaciens. Microb. Biotechnol. 8: 281-295. https://doi.org/10.1111/1751-7915.12238
- Chithrashree AC, Udayashankar AC, Chandra NS, Reddy MS, Srinivas C. 2011. Plant growth-promoting rhizobacteria mediate induced systemic resistance in rice against bacterial leaf blight caused by Xanthomonas oryzae pv. oryzae. Biocontrol 59: 114-22.
- Chowdhury SP, Hartmann A, Gao X, Borriss R. 2015. Biocontrol mechanism by root-associated Bacillus amyloliquefaciens FZB42 - a review. Front. Microbiol. 6: 780. https://doi.org/10.3389/fmicb.2015.00780
- De Vleesschauwer D, Xu J, Höfte M. 2014. Making sense of hormone-mediated defense networking: from rice to Arabidopsis. Front. Plant Sci. 5: 611. https://doi.org/10.3389/fpls.2014.00611
- Desoignies N, Schramme F, Ongena M, Legrève A. 2013. Systemic resistance induced by Bacillus lipopeptides in Beta vulgaris reduces infection by the rhizomania disease vector Polymyxa betae. Mol. Plant Pathol. 14: 416-421. https://doi.org/10.1111/mpp.12008
- Farace G, Fernandez O, Jacquens L, Coutte F, Krier F, Jacques P, et al. 2015. Cyclic lipopeptides from Bacillus subtilis activate distinct patterns of defence responses in grapevine. Mol. Plant Pathol. 16: 177-187. https://doi.org/10.1111/mpp.12170
- Gonzalez JF, Myers MP, Venturi V. 2013. The inter-kingdom solo OryR regulator of Xanthomonas oryzae is important for motility. Mol. Plant Pathol. 14: 211-221. https://doi.org/10.1111/j.1364-3703.2012.00843.x
- Hwang SH, Lee IA, Yie SW, Hwang DJ. 2008. Identification of an OsPR10a promoter region responsive to salicylic acid. Planta 227: 1141-1150. https://doi.org/10.1007/s00425-007-0687-8
- Kauffman HE, Reddy APK, Hsieh SPY, Merca SD. 1973. An improved technique for evaluating resistance of rice varieties to Xanthomonas oryzae. Plant Dis. Rep. 57: 537-541.
- Khan MA, Naeem M, Iqbal M. 2014. Breeding approaches for bacterial leaf blight resistance in rice (Oryza sativa L.), current status and future directions. Eur. J. Plant Pathol. 139: 27-37. https://doi.org/10.1007/s10658-014-0377-x
- Kim PI, Pyoung IL, Jaewon R, Young HK, Youn TC. 2010. Production of biosurfactant lipopeptides iturin A, fengycin, and surfactin A from Bacillus subtilis CMB32 for control of Colletotrichum gloeosporioides. J. Microbiol. Biotechnol. 20: 138-145.
- Li S, Fang M, Zhou RC, Huang J. 2012. Characterization and evaluation of endophytic Bacillus B014 as potential biocontrol agent for controlling bacterial blight of Anthurium caused by Xanthomonas axonopodis pv. dieffenbachiae. Biocontrol 63: 9-16.
- Liu J, Hagberg I, Novitsky L, Hadj-Moussa H, Avis TJ. 2014. Interaction of antimicrobial cyclic lipopeptides from Bacillus subtilis influences their effect on spore germination and membrane permeability in fungal plant pathogens. Fungal Biol. 118: 855-861. https://doi.org/10.1016/j.funbio.2014.07.004
- Mora I, Cabrefiga J, Montesinos E. 2015. Cyclic lipopeptide biosynthetic genes and products, and inhibitory activity of plant-associated Bacillus against phytopathogenic bacteria. PLoS One 10: e0127738. https://doi.org/10.1371/journal.pone.0127738
- Perez-Garcia A, Romero D, de Vicente A. 2011. Plant protection and growth stimulation by microorganisms: biotechnological applications of Bacilli in agriculture. Curr. Opin. Biotechnol. 22: 187-193. https://doi.org/10.1016/j.copbio.2010.12.003
- Raaijmakers JM, De Bruijn I, Nybroe O, Ongena M. 2010. Natural functions of lipopeptides from Bacillus and Pseudomonas: more than surfactants and antibiotics. FEMS Microbiol. Rev. 34: 1037-1062. https://doi.org/10.1111/j.1574-6976.2010.00221.x
- Rahman A, Uddin W, Wenner N. 2015. Induced systemic resistance responses in perennial ryegrass against Magnaporthe oryzae elicited by semi-purified surfactin lipopeptides and live cells of Bacillus amyloliquefaciens. Mol. Plant Pathol. 16: 546-558. https://doi.org/10.1111/mpp.12209
- Takatsuji H. 2014. Development of disease-resistant rice using regulatory components of induced disease resistance. Front. Plant Sci. 5: 630. https://doi.org/10.3389/fpls.2014.00630
- Waewthongrak W, Leelasuphakul W, McCollum G. 2014. Cyclic lipopeptides from Bacillus subtilis ABS-S14 elicit defense-related gene expression in citrus fruit. PLoS One 9: e109386. https://doi.org/10.1371/journal.pone.0109386
- Xu J, Audenaert K, Hofte M, De Vleesschauwer D. 2013. Abscisic acid promotes susceptibility to the rice leaf blight pathogen Xanthomonas oryzae pv oryzae by suppressing salicylic acid-mediated defenses. PLoS One 8: e67413. https://doi.org/10.1371/journal.pone.0067413
- Xu HM, Rong YJ, Zhao MX, Song B, Chi ZM. 2014. Antibacterial activity of the lipopetides produced by Bacillus amyloliquefaciens M1 against multidrug-resistant Vibrio spp. isolated from diseased marine animals. Appl. Microbiol. Biotechnol. 98: 127-136. https://doi.org/10.1007/s00253-013-5291-1
- Xu J, Zhou L, Venturi V, He YW, Kojima M, Sakakibari H, et al. 2015. Phytohormone-mediated interkingdom signaling shapes the outcome of rice-Xanthomonas oryzae pv. oryzae interactions. BMC Plant Biol. 15: 10-18. https://doi.org/10.1186/s12870-014-0411-3
- Yamamoto S, Shiraishi S, Suzuki S. 2015. Are cyclic lipopeptides produced by Bacillus amyloliquefaciens S13-3 responsible for the plant defence response in strawberry against Colletotrichum gloeosporioides? Lett. Appl. Microbiol. 60: 379-386. https://doi.org/10.1111/lam.12382
- Yi HS, Yang JW, Ryu CM. 2013. ISR meets SAR outside: additive action of the endophyte Bacillus pumilus INR7 and the chemical inducer, benzothiadiazole, on induced resistance against bacterial spot in field-grown pepper. Front. Plant Sci. 4: 122. https://doi.org/10.3389/fpls.2013.00122
- Zeriouh H, Romero D, Garcia-Gutierrez L, Cazorla FM, de Vicente A, Perez-Garcia A. 2011. The iturin-like lipopeptides are essential components in the biological control arsenal of Bacillus subtilis against bacterial diseases of cucurbits. Mol. Plant Microbe Interact. 24: 1540-1552. https://doi.org/10.1094/MPMI-06-11-0162
- Zhang RS, Liu YF, Luo CP. 2012. Bacillus amyloliquefaciens Lx-11, a potential biocontrol agent against rice bacterial leaf streak. J. Plant Pathol. 94: 609-619.
피인용 문헌
- Screening of bacterial endophytes as potential biocontrol agents against soybean diseases vol.125, pp.5, 2016, https://doi.org/10.1111/jam.14041
- Screening and identification of Aspergillus activity against Xanthomonas oryzae pv. oryzae and analysis of antimicrobial components vol.57, pp.7, 2016, https://doi.org/10.1007/s12275-019-8330-5
- Mecanismos de acción de Bacillus spp. (Bacillaceae) contra microorganismos fitopatógenos durante su interacción con plantas vol.25, pp.1, 2016, https://doi.org/10.15446/abc.v25n1.75045